Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2312
Contig Information
Length 1219 bp
Tissue Liquid cultured tissue
Clones 6 Clones [Download: CSV  ,  FASTA ]
whvs1e23    whvs4e20    whvs12l07    rwhvs1e23    rwhvs4e20    rwhvs12l07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit histone deacetylase HDAC2 [Triticum aestivum]
Score 1054
Evalue 1.18278e-112
Total Hit Count 289
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2312
ACCCATCCCCTCCCTCCGTCGGCTTAAACCCTAGACCGCCGCCACCCTCCGCCGCCGCCGGTTGACATGGAGTTCTGGGGCCTTGAGGTTAAGCCTAACC
AGTCCCTCAAGGTTTCACCTGATGATGACCACTTCCTCCATCTCTCCCAGGGTGCCCTTGGTGAAGTCAAGAAGGATGACAAGGCTACCATGTTCGTCAA
GATTGGCGACCAGAAGCTAGCCATCGGGACCCTCTCTACTGACAAGTTCCCTCAGATCCAGTTCGACCTCGTCTTTGAGAAGGAGTTTGAGCTCTCACAC
AATTCCAAGACGTCCAGCGTCTTCTTCTCTGGCTACAAGGTTTTCCAGCCTGCCGACGGAGATGAGATGGATTTTGATTCCGAGGACGAGTCTGAGGAGG
AGCAAGACACCATCATTCCAGCACTCACCAAGGAGAATGGCAAACCTGAAGCCAAGGAGCAGAAGAAGCAGGTTAAGATTGACACTGCTGCCCCTTCAAA
GTCCAAGCCTGCTGCTAAGGATGGGGGAAAATCTAACAAGGATGATGACAGCGATGATGATGATGACAGTGATGAGGATGACAGCCAAGATGACTCTGGT
GATGATGGAGCATTGATTCCCATGGAGGATGATTCTGATGATAGTGAGGACGGTGATGATTCCTCTGATGATAGTGAGGATAGCTCTGATGAGGAGGAAG
AAGAAACACCCAAGAAGCAAGAGACTGGGAAGAAGAGGGCGGCTGGAAGCGTGTTGAAGACCCCTGTTACTGACAAGAAGGCCAAGATTGCAACACCGTC
AGGCCAGAAGACAGGTGACAAGAAGGGAGCTGTCCATGTGGCGACTCCTCACCCGGCCAAGAAGGCAGGCAAGACCCCGGCTACCAGCGACAAGTCGCCC
AAGTCTGGAGGGTCGGTCGCGTGCAAGTCGTGCAGCAAGACATTCAACAGCGAGGGCGCTCTAGCTTCGCACTCCAAGGCAAAGCACGAGGCCAAGTGAA
GAGGAGAGGAAGGTGTTGGCTGGCTGGCTGGCTCCAGTTGCTATTATTTTGATCTGTCTGCCCTATTGAGATTATTATCGTTATGCTGCTGTGTTAGGCT
ATCTGCTATATCTTATTATGTTGTCGTACCTACCTAGCCTGATCCTGAGGGAAGGGAAGGGAGAAACCGTTGAGCTGTTAGTGTTGATGCGTTTGTTGTG
AATCGAACAAAAAAGCCGC
page-top