Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2295
Contig Information
Length 955 bp
Tissue Liquid cultured tissue
Clones 6 Clones [Download: CSV  ,  FASTA ]
whvs1a06    whvs8l14    whvs9d18    rwhvs1a06    rwhvs8l14    rwhvs9d18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RNA-binding protein cabeza [Zea mays] >gi|195622928|gb|ACG33294.1| RNA-binding protein cabeza [Zea mays]
Score 639
Evalue 1.07002e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2295
CGCCTCGACGTCGGTGCCGTGCCGTGCCGCCGCGAGCACACAGATCCCAAAACCCGAAAGAAATCCCAACATAAAGAGGCAAGATGAACAGGAAGCCAGG
CGACTGGGACTGCAGGTCGTGCCAGCACCTCAACTTCAGTCGCCGGGACCTATGCCAGCGCTGCGGCGAGCCACGCAGTGCCGCTGACCGTGGCAGCGTC
GGTGGCGCTCTTGGTGGTGACTACGCCAACTTTGGCGGCCGTGGCGGGGGTGGTTCCTCCTTTGGTACCGGCTTTGGTGCCGGCTCTGACGTCCGCCCGG
GCGACTGGTACTGCACCTGCGGGGCGCACAACTTCGCCAGCCGCTCCAGCTGCTTCAAGTGTGCTGCCTTCAAGGAGGAAGCTGCCGTCAATGGTGGCGC
TGGTGGCTTTGATGGTGACATGTCACGCTCAAGGGGCTTCGGCTTCGGCGCTGTCGGTGGCATGGGTGGCGGCATGGGAGCCGGCGCGGCCGGTGGTCGT
GCCAGCCGCCCTGGCTGGAAGTCTGGCGACTGGATTTGCACCAGGTCTGGATGCAACGAGCACAACTTCGCCAGCAGGCAGGAGTGCTTCAGGTGCAACG
CACCGAGGGACTCCGGTAGCGCCACGCCATACGAAAATTTCTTGCACTGAGGTGTAGGAAGGCCATGGCGGCGGCGATGAGCAGAAGCAGCAAAGGGTGT
CCGTGTCCCGCAGTCGACATCATCATCATAAGAAGAAGAAGAAGAAAGTAGAATGCAAAGAAATCCTCCTCGAGTGCATGCTTACTAGTTTTGTCTCTTC
CCGTTTTAGATTTGGTTGTCATTTCCCATTTGGGACCGTCCGTCTGTCCGTCTGATCGATGATGACTAGCTATGTTTACCGTTTTATTATTTCCGTTCCT
TTCATCAAGTTTGCAGTTCGAGTTATGTAACCCAAAGACGTATGCTTGCTCAGAA
page-top