Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2277
Contig Information
Length 692 bp
Tissue Liquid cultured tissue
Clones 6 Clones [Download: CSV  ,  FASTA ]
whvs1a09    whvs17a02    whvs20f23    rwhvs1a09    rwhvs17a02    rwhvs20f23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100194345 [Zea mays] >gi|194695580|gb|ACF81874.1| unknown [Zea mays]
Score 599
Evalue 2.61724e-60
Total Hit Count 343
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2277
CCCTCGCGCCGCCGCACCACCAACCAGCGCCGTCGCCGCCGCCGCCGCCGGAGAAGGAGAGGGAGCAGCCGCAGCCATGGGTCGCGTCCGCACCAAGACC
GTGAAGAAGACCTCCCGCCAGGTCATCGAGAAGTACTACTCTCGGATGACCCTCGACTTCCACACCAACAAGAAGGTGCTAGAGGAGGTCTCCATCCTCC
AGTCGAAGCGCCTCCGCAACAAGGTGGCCGGCTTCACCACCCATCTGATGCGCCGCATCCAGCGCGGCCCCGTGCGCGGCATCTCCCTCAAGCTGCAGGA
GGAGGAGCGTGAGCGCCGCATGGACTTCGTGCCGGAGAAGTCGGCGCTCGAGGTCGACGAGATCCGCGTCGACAAGGAGACCATGGACATGCTGGCGTTC
CTCGGCATGGCTGACCTCCCCGGCGTCGAGCGCGCCCCCGAAACCACCTCTGCCGCCGCCCCCTACCGCCAGCCCTTCAACGGACCCCGCGGTGGCAACC
GCGCCTAGGTTCCTCCGCATCGTCATCGTACCCCTATATTATGCTTTATGTCTTTTAGATCTGTTACTTGTGGCAAGTAATGTTTTGAACTCAAGGCTTA
AGTTCGAGGTGTTTTGATCTGCGTATGGTGGACATGATCTGTTTATCTCACCGTTTATCTGAAGTGATTCGATATATTACTGTTAAAAAAAA
page-top