Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2275
Contig Information
Length 1387 bp
Tissue Liquid cultured tissue
Clones 6 Clones [Download: CSV  ,  FASTA ]
whvs8e24    whvs9o18    whvs18o13    rwhvs8e24    rwhvs9o18    rwhvs18o13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Fructose-bisphosphate aldolase cytoplasmic isozyme; AltName: Full=Gravity-specific protein GSC 233 >gi|41398198|gb|AAS05825.1| fructose 1,6-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|50878379|gb|AAT85154.1| putative fructose-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|50878433|gb|AAT85207.1| putative fructose-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|125594188|gb|EAZ34247.1| hypothetical protein OsJ_017730 [Oryza sativa (japonica cultivar-group)] >gi|169244417|gb|ACA50482.1| fructose-bisphosphate aldolase [Oryza sativa Japonica Group]
Score 1720
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2275
CCGCACCCCATCACCTGCCTGCCAACTAGCCCCAAATCTCCCCTCCCTCCCCCGCTCTCGAATCCCCCCGAGCATCGACCATGTCGGCCTACTGCGGAAA
GTACAAGGATGAGCTCATCAAGAACGCTGCCTACATTGGCACCCCCGGCAAGGGTATCCTTGCTGCCGACGAGTCCACCGGCACCATCGGCAAGCGCTTT
GCCAGCATCAATGTTGAGAATGTTGAGGACAACCGCCGTGCCCTCCGTGAGCTCCTCTTCTGCACCCCTGGAGCCCTCCAGTACCTCAGTGGTGTGATCC
TCTTTGAGGAGACACTGTACCAGAGCACCAAGGGTGGCAAGCCCTTCGTTGACATCCTCAAGGAGGGCAACGTCCTCCCTGGCATCAAGGTGGACAAGGG
TACCGTCGAGCTCGCTGGAACCAACGGTGAGACCACCACCCAGGGCTTTGATGACCTTGGCAAGCGCTGTGCCAAGTACTACGAGGCTGGTGCCCGCTTT
GCCAAGTGGCGTGCCGTCCTCAAGATTGGCCCCACCGAGCCATCACAGCTTTCCATCGACCAGAATGCTCAGGGTCTGGCTCGCTATGCCATCATCTGCC
AGGAGAATGGGCTGGTGCCCATTGTTGAGCCTGAGATCCTTGTTGATGGACCTCATGACATTGACCGCTGTGCTTACGTGACTGAGATGGTCCTTGCTGC
GTGCTACAAGGCCCTCAACGACCAGCATGTCCTCCTTGAGGGCACCCTCCTGAAGCCCAACATGGTCACCCCTGGATCCGACGCCAAGAAGGTGGCCCCT
GAGGTGATTGCTGAGTACACCGTCCGCACCCTCCAGAGGACTGTCCCTGCTGCCGTCCCAGCCATTGTCTTCCTCTCTGGTGGACAGAGCGAGGAGGAGG
CGACCCTGAACCTGAACGCCATGAACAAGCTCGAGACCAAGAAGCCATGGAACCTGTCCTTCTCCTTCGGGCGTGCCCTCCAGCAGAGCACCCTCAAGGC
CTGGGCTGGCAAGGTGGAGAACGAGGAGAAGGCCAGGAAGGCGTTCCTGGTGAGGTGCAAGGCCAACTCTGAGGCCACCCTCGGCACCTACAAGGGCGAT
GCCACCCTCGGCGAGGGGGCCTCTGAGAGCCTCCACGTCAAGGACTACAAGTACTGATCTGCCTTCGGTGCGGTGGCCTGTTTGGGTGTCCTGCTTACCA
GTATTATCGTTTGGTTTTCAGAGTCTTGATATATCCTTCGGATATCGAACCTAGTATGGAACTTGTGCTCTCAAAATAGCTTAGGTAGTTTCGTTTTTGG
AGTCGAATACCCTGTTACTCGGGTGCTGCGTATCGTAAATCGGAGCGGTGGTTTTTGTTCTACTATGGTCGTGTAATTTTGCTGCTA
page-top