Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2254
Contig Information
Length 501 bp
Tissue Liquid cultured tissue
Clones 5 Clones [Download: CSV  ,  FASTA ]
whvs1b02    whvs16c19    rwhvs1b02    rwhvs16c19    rwhvs16d09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0172600 [Oryza sativa (japonica cultivar-group)] >gi|47497376|dbj|BAD19414.1| 40S ribosomal protein S30-like [Oryza sativa Japonica Group] >gi|51090595|dbj|BAD36047.1| 40S ribosomal protein S30-like [Oryza sativa Japonica Group] >gi|55773694|dbj|BAD72277.1| 40S ribosomal protein S30-like [Oryza sativa Japonica Group] >gi|113594981|dbj|BAF18855.1| Os06g0172600 [Oryza sativa (japonica cultivar-group)] >gi|118482205|gb|ABK93031.1| unknown [Populus trichocarpa] >gi|118483097|gb|ABK93458.1| unknown [Populus trichocarpa] >gi|118483320|gb|ABK93562.1| unknown [Populus trichocarpa] >gi|118484154|gb|ABK93960.1| unknown [Populus trichocarpa] >gi|118484319|gb|ABK94037.1| unknown [Populus trichocarpa] >gi|118487828|gb|ABK95737.1| unknown [Populus trichocarpa] >gi|195607768|gb|ACG25714.1| 40S ribosomal protein S30 [Zea mays] >gi|195610010|gb|ACG26835.1| 40S ribosomal protein S30 [Zea mays] >gi|195616154|gb|ACG29907.1| 40S ribosomal protein S30 [Zea mays] >gi|195617990|gb|ACG30825.1| 40S ribosomal protein S30 [Zea mays] >gi|195618464|gb|ACG31062.1| 40S ribosomal protein S30 [Zea mays] >gi|195619280|gb|ACG31470.1| 40S ribosomal protein S30 [Zea mays] >gi|195626382|gb|ACG35021.1| 40S ribosomal protein S30 [Zea mays] >gi|195639864|gb|ACG39400.1| 40S ribosomal protein S30 [Zea mays]
Score 314
Evalue 1.26103e-27
Total Hit Count 245
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2254
TTTTTTTTTTGGAACAATCTAGACGCATATGTTGCACATCATGGGCAACGACAAACAACAAGCAAATTTAAGCCATGAACCCATACCACAATATCTCAGA
TTCTTCAACTAAGCAAAACATGCATACTTTAACACTTCAGTAATGTCTCTTCCATCATCATAATCTTGCGTAACAACAAACGAGAGGAAAACTAGCGCAA
AGGAAGAGCCTTTTTCTTGGCTCGGCGGTGCGGCGCGCCTACTTCTCGGAGGAGTTGGGGCCGCGCTTCTTGCCGAAGCCGACGACGGCGGTGACGAAGC
GGCGGTTGTACTGGATCCTCTTGTGGGCGCGGCCGCGGGGCTGCTTCTTCTTGTCCTGCTTCGCGACCTTGGGCGTCTGGCCGCGCACCTTCCCGGCACG
GGCGAGCGATCCGTGCACCTTACCCATGTCGACGGCGGCGGTGGGGCGGCGGAGAAGGAGGGTTGGAGGCGAGTGCGCGAGGGTTTGCGACGGCGGCGGC
G
page-top