Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2240
Contig Information
Length 1197 bp
Tissue Liquid cultured tissue
Clones 5 Clones [Download: CSV  ,  FASTA ]
whvs1f12    whvs11a12    rwhvs1f12    rwhvs11a12    rwhvs14k22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_004366 [Oryza sativa (japonica cultivar-group)]
Score 1182
Evalue 1.65579e-127
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2240
TTTTTTTTTTACCCAGCGACTGTTCTTTTTTAATTATAGCTTGGCAATTTGCCAGAGCATCAGATACCAAACAAGTAAAAACCTTCATCAGGATCCATCA
AACACTTCTTTTTCTGTACACTTATTACCACACCAATGCGATTGCGCAAAGCCAGAGCAACAAATAATGGCGCTTGGCAAACGGACTGACTGACTGACGG
CTTCGGCTTCGGCTTTCGCTTGCCAGACACGATCTGCGGAGGATGGTCGGCTGCCGGAGAACCCTTGCACTGTAGTACATCATCGCTATCCCCGCGCCCA
ACCGGAGCTGGCGCCGGAGCGTCGCTAGACTAGGTAGTCATAGTAGACCAGCAGGAGGTTGTCGGGGACGATGAGGGGCAGGCTGTCGATGAAGCTGTGG
AAGTGCCTCACATTCTCCTTCTCCAGGGTCACCGGGTCGATCACGTCCTCGTCGCCAGTGAGCACCCACAGGTCCCTGGACTGGACTCGCTTCAGGCTTC
CGCGGCAGAATGGGCACGACTGGGATCTTGTGTACCAGTCTCGGTAACAGTTGATGCACATGGCATGGTTGCAGTTGGGAAGGACCATCTTGGTGCAGGC
CTCCAGGCAAATGCCGCACTCGTCTTCCCTCTCGGCGTCCTTGTCATCGGCGTAAAGCTTCCGGCGGCCGCCGCTGTCGCCGTCCCCCTTGCACCACCCC
TTCTCCTTGCAGTCTCTCGCCATGACGTTCTCCTCAATTTGTTGCAAGTAGGGGTATATTATGGCGTAGAATTCTTTGAGGCTCGCTCGCCTTTCGATGG
TGGATATGGAGGCATCCCCATCAACATAAACCTTGTAGACGAGAACCTCGAGAAGGCCCAGGTAGCTGGGGAGGGTGTAGGAGAGGGAGCAGCTGCAGTC
CATCCACTGGATAAGGTTGAGGATGATTGGAGCCATGGAGCTGTAGGACAGCCTCATCTGCACGCATGTACCCCCGTAGGCCCTGTGGATAGCATGCGCC
AGGGTGTTGGCGTGGTGGATATCGGCTTCGAGGGCCTTGAGGGAGCCCCTGAGGGACAGCGGCCTGCCACCGTGAAGCATGGCTCTTCTCCGGCAACCCA
AGAACCTCCTGTGGCTGTGGACTAGTATGGTTCAGAGAGAGAAACTTGGGGGAGGAGGAGAGGGGCTCGAGGAAGCAAGAGGCGACCGGGCTACCAA
page-top