Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1334
Contig Information
Length 1026 bp
Tissue Callus
Clones 3 Clones [Download: CSV  ,  FASTA ]
whcs3i05    rwhcs10b15    rwhcs3i05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_34164 [Oryza sativa Indica Group] >gi|125575260|gb|EAZ16544.1| hypothetical protein OsJ_030753 [Oryza sativa (japonica cultivar-group)]
Score 674
Evalue 1.07906e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1334
CAGCTTCACCATCCAGGGTTCCGTGTGTACAATGAGTACAGAGTTTTCGCAACTCTTGTCATCAGATGTATTTCACTCAAAAGGGGGTAAAAAGACTAAT
AAAACAAGCACGTTTGGCAGTACATCCTTGGAAATAACCAAAGCCCAGATTATTTTTGTCAACAAACATGATCTAAGTTACACCGCTGAACCTAGTTAAT
GTGGCAGCATGGCAATCGACCTGGAGTTTGCACGGTGTTCCGTTGCTCTTCACCACAAGCCTCTAGGGTTTAGTTCCACCTTGGATAATGGACGTCGCGA
GAAGACTGGGATGGCTGCACGCTCTGGCTGTTGGCACCAATGAAGCCTTGCAGAAGGCTCTGTGCCACTCTCACTTGGTCCGGCATACCTTGGATCTCCA
TGATGGATTCCGAAGAACCGGGACGGGCTTCAAGTAACTTCATTCTTGCACCAGAGATCTGGCGGATCTCTGCTAGATTGACACCACCAGCTCCAACAAT
AGATTCCAGAGAACTATTTGGAATCCTCAGCTCAACAGAGCTACTTGAATACCCTGTAACATCTGCCGCTCTTTGATAATCCTCACGTCCATGCATCTGC
CCGGCAGCCTCAGTGTAATCATAAGCATTGGAATTTCCAGCTCTGGTGACGCCTAATTGTTGCATATTACTATTCCCAGTTCTTGAGAGGCCTAATTGCT
GAATGCCTCTACTAGAATAGCTATCAGTAGGCATATGGTCATGATAAGAACGATGCGACATGTAATCAGCACCAGGACTAACAGGCAAGGGCATTTCTCT
AGTAGGCAAGCGAGCAGATGCTGCATATCTATCATAAGAAGCAGATGGTGGAGCGTCGCCTAGCAAATGGACTTCCACTAGGATACTCTCTTCTTTTAGA
GAAGTAATCTACTGAATCATGGGGTTTATTGTTTGGTCTGCCATATGGTGCATCGTTGGCAGGTCTCCCATATGGTGTGTCGTTGGCAGGTCTCCCATAT
GGTGTGTCGTTGGCAGGTCTTCCATA
page-top