Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2098
Contig Information
Length 1604 bp
Tissue Liquid cultured tissue
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvs14b02    rwhvs1f16    rwhvs14b02    rwhvs19i01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0697200 [Oryza sativa (japonica cultivar-group)] >gi|41052947|dbj|BAD07857.1| unknown protein [Oryza sativa Japonica Group] >gi|41053211|dbj|BAD08173.1| unknown protein [Oryza sativa Japonica Group] >gi|113537348|dbj|BAF09731.1| Os02g0697200 [Oryza sativa (japonica cultivar-group)] >gi|215736894|dbj|BAG95823.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765307|dbj|BAG87004.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218191406|gb|EEC73833.1| hypothetical protein OsI_08567 [Oryza sativa Indica Group]
Score 771
Evalue 1.59535e-113
Total Hit Count 83
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2098
TCAGATTGGAAGCTGCCAGTGCAGGCGCTGATGAAAGCTATGCACATGGTACAAACCGCTACCTGAAGAAAGTAGTTTACACCTTACAATTTTCATTACA
CTGGAGAACTGGATTAAGCTAATATATATTGATACTGGGTAGTATTTCACAAATTTTGAGCGACAAGGTCATGAACGCGTCATCTTTACCCACTTGGAAC
TTAGTTGAATAGGCAGGCAACAATTCCTGCCAATCTGAAGGGATTGAGCTAATCCTTACCTATCCAGACAAGCATTTACTGCAAATTACAGCAAATTCAT
ATTCATATGTAAGAATACCCTAACACTTGCTTGAAAAAGTACTGGCTGGCATAAAACAGTGGTTGCAGAATTCCATCAGCATGTTCAGTTACATCATAAT
TTGAGTGCATATTTCAGTTCTTCCCGAAGTGAAAGGGATCCTTGGTGAGCCACTATATGGCTTTTGGCACTCAATTTTCTCGGGGATTTTTCATCGATTG
CTGCATGAGGTACCTGCCAGTGTAGAACCCTGCTGTATACCATGCATTCAGTACGACAGCGAGATCACTGTTTGCTCCTGTGGTGTCTAAATTCAGGTTC
ATGCCCACAGTTGTGTTATTCTCCTTTCCAATTCCACCTTCATTTCTCATATTTGGAAAGGAGGCAGCATCTCCAGATATTGTATTTCTCATGAAATTCA
TGGCACCTTCAGCAGTCATCATTGCAGCCTTAGCAACTTGATCATCGCCAGTAGATACCTTAGTTGGGAGCTGCGTAAAAGGCTGAACCAGTAGGATATG
TAGTGCTTGCTCCAGGGCAATGATCACAAGTGAACGATACGCTGCAGCCTCCATTAGGTAGCATACCAGAGGAATCGCCACTTTGTTGCCCAGTTGAACA
GCAGGAGATTGAAACCATGGGAGCATTCAAGGAGCAGCATGAGGTTTGAGTGGTTGAAGAGTTTGGGTCTGGTGCTGTGACAATGTAAGCAGGAACTTGC
TGCTGTTGGTATGCTGAAGATTGTTCAGGGGTTTGATAATTCCAATAATTTGTCTGATGTAATTGCTCAAGAACTTTCTGGCTTTGCACCTCAAGTTCAT
AGTACTTCCTGAGTAATTCATTATAGTCCTCTGTCTGCTGGTTTGAGCTATCCTTTCCCTCAGTATTGGTGACATCTGAGAAGCATGTCTTAGATTCAGA
GATATTTGTCTCTTTGCCCAGATTTGTTTCTCGAAGAGGAGCTTGCTTATCGGTCTTTCTTTCTTCACAGGGCTGCTGTGGTGTCTCCACTGGACCAATG
GGTAAGTTAGTGCAGCTGTCATTTTTCTCTGTTTGCTCATCTGCCACTTCAGTAGAGACAGGTTCTTCTGCAACAGCAGCGGCAGTGTACGCGGCAGCGG
AATCGGCAGCGGCAGCTACATCTTCTGACTCTTGTTTCTCGGATGGAGCACCTTGGTTGTTCTTGCCATGCATTGCCTTGTAGGTGGCGACGGCGTGGTC
GAAGGCGTCCACCAGCGCCGAGTCGTCCCACAGCTCGCCGCCCTTCCCCATCTCCTCTCTCGCCAACTTGTCACGCTCACGGCTTCCTCCTCTGACCTGC
TGCG
page-top