Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2082
Contig Information
Length 913 bp
Tissue Liquid cultured tissue
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvs17a20    rwhvs16g06    rwhvs17a20    rwhvs20h03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100217027 [Zea mays] >gi|194697434|gb|ACF82801.1| unknown [Zea mays]
Score 1107
Evalue 5.42176e-119
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2082
TTTTTTTTTTGGAAAGCAGCAAATTAGATGGTTCGATAGTAAAGGTTCTGAGGCACCAAGTGCGGCAACCAGCTTAGGAACACAACATCCCAGGAGTCCA
ACAGGCCATCACAGGCCACTACTACATACTACTAGTACTAGATAACCAAGCGCATCGCCAAAAGTTGGAACGCGCAAGTGCGGCTGGCTGGCTGGCTCAG
CAGAAGAACATGCTGCTGCGGACTTTCTCATGGAGGCGAGGCAGCTCCTGCACTGGAGCGCTGCCGGCAGAGGTGTGGCCACCTCCCTGGCTCGACGACG
TCTCGGACATCTCATCAAACTTTATGAACTGCGCCACCTGAGCAGCCGCAAGATGTGCATAGCAGATTGGAGAAACAACTGATATGGCTGTCGTGCTCCT
TTGATACACATATGAGAGCGAGTGCACAAGATCCTGCAGGTCATCCGCGGCAAAGTGTATCTCATCATGCAGGATATGGTAGTGTGTTGGCCTTGTAGTC
CCAATCATTCCAGCATGAGCGCACATGTAGAAGTCATAATTCCTTGGATGGCAGACTGCATTATCTACAACAGTGCCTGGAGGGACATTGTCAGGAGATC
CAGGTATGAAGAATTTGGTGTGGTGATTTTTCTGGGCAACAATCAGCGTGAACTTGGGGTTCCAATTTTCATCCAAGAACTTGCAGGCCTCAATTATTTG
ATCCAATTCAATGTTCAGCACCTGATTAAACTGGCTCTCACTAACACCATCCCTGAAGATGATGATCTGATCTGGTTTCCTTTTTCCAGAACTGGTGTAG
AAGTCAATGAGACACTCCCGAACAAGGCCATCATCATCAGTTCCTTGTGGCTTGAACAATGAATCTATCATTTCTAGCTTTGGGTGACTGCGANCGCACT
GAANCCCTATATT
page-top