Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1320
Contig Information
Length 822 bp
Tissue Callus
Clones 3 Clones [Download: CSV  ,  FASTA ]
whcs10a11    whcs8g10    rwhcs10a11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit homeobox-like resistance [Triticum aestivum] >gi|167882868|gb|ACA06113.1| homeobox-like resistance protein [Triticum aestivum]
Score 863
Evalue 8.81652e-91
Total Hit Count 41
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1320
CAGGGGACCCGGAAGTAAAAGTTCGATTTTCTGGATTTGGGCCTGAGGAGGATGAATGGATTAATGTTCGTAAATGTGTGAGGCTGCGTTCTCTTCCATG
TGAATCTGCAGAATGTGTTGCTGTGCTTCCTGGGGATCTCATTCTTTGTTTTCAGGAAGGCAAAGAGCAGGCCCTCTATTTTGACGCTCGTGTTCTTGAT
GCTCAAAGGCGCAGGCATGATGTAAGAGGGTGCCGCTGCAGGTTTCTTGTTCGTTATGATCATGATCACTCTGAGGAGATTGTTCCTCTGAGGAAGGTAT
GCCGTCGACCAGAAACTGATTTCAGGCTCCAGATCTTGCACGCATCTAGAGCGGCGGCCTCTGCGGATGCTCAGAATGTTAGCCCAGTTGAGCAGAAACC
CCAAAAGGCGCACAAGATGATGGATGTGAACACTGCCGAGGTGACCGTGGTTCGCAACCCAGATCAAGGAGGGCCATCTGACAAGCCGGCTGCTCCCTTA
CCAGCTGCGCCTGCTGGCACCCACGGTGATTCAGTTTCAGATGTGCAGATGGGGAATGTGGAGGTTATTCCAAAAGTTGAAGCTGCAAATGAAGCACATG
ATGACAACATGAACGTGGGAGCGTAGTTGTTTCGCTTCCCTGTGCGCTTCGGTGTGTACTTACTAAGTCCAAAAAAATGTTTGCTTAGGAACTTCCGGTC
GAGGAAGGATGGTCGCCCGGTAACTGTAATGTGCCGATGTCGACTTGTTTGCTGATGTGTGTACAAAGTCTTGGATTGTCGGTATCTATATAGCTATATC
GTGAGACGAATGTTGTTTTCTG
page-top