Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig2031
Contig Information
Length 1404 bp
Tissue Liquid cultured tissue
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvs1f07    whvs14c12    whvs14c23    whvs14c24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit CAA303719.1 protein [Oryza sativa] >gi|90399022|emb|CAJ86142.1| H0701F11.8 [Oryza sativa (indica cultivar-group)] >gi|116311976|emb|CAJ86334.1| H0814G11.1 [Oryza sativa (indica cultivar-group)]
Score 1376
Evalue 4.40339e-163
Total Hit Count 298
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig2031
GTCGGCACTGCCGCTGCGACTTCTTGGCGAGCGCTCGGATCAGGTTTCACTGCGCGAAGAAGCCGCCGGATCTTCTCCGAAGGTTGGCCGAGATCCCGAG
TGCAAATCTGAACCCCGTGCGTCTCCGAGTCTCGGGGGATTCCATGCGAGATTTTGATTTTGGGGATCTTTCTTGTTGGATAACAGTTCAGCGGCCGTCC
GATCTGCGCTCTCTACACCAGTGATTGCACTTTTTGCTGTTGTACCCTGCTGCGGTTGGTTACTCAGGGTTTGCATCAAGTCCAAAGATGACTTTGCGCA
GCATAGTTCGCGATTTAAGGGAGAGCTTTGGAAACCTGTCAAGGCGGAATTTCGAGGCGAAAATCTCAAGCGTCCCAAGCCTTTCGGGCCATCACAGAGG
GAAATCGCTTGAATCTGCAAGTGATCTGCAGGATAGTCTTGTCACAAACCTGCAAGGCAATTGGGCTAGCCTTCCTCCTGAATTACTTCGGGATGTGATG
AAAAGGCTGGAGGAAGACGACAGCAATTGGCCATCCCGCAAGGATGTTGTTGCTTGCGCTTCTGTCTGTACAACTTGGAGAGAGATGTGCAAGGATATAG
TGAGGAATCCAGAATTCTGTGGAAAGCTCACCTTTCCTGTGTCCCTTAAGCAGCCTGGATCTCGAGATGGATTGATCCAGTGTTTCATCAAAAGGGACAA
GTCAAAGCTAACTTATCGTCTCTACCTGTCCCTTACTTCTGCTGTGCTTGATGATAATGGCAAGTTCCTACTGTCAGCTAAAAGGAGTCGGAGAACAACT
TACACCGACTATGCCATTTCTATGGATCCTAAAAATATATCCCGGTCAAGTAGTGGCTACATCGGGAAATTGAGGTCAAATTTCCTCGGCACCAAATTCA
TCATCTACGACACGCAGCCGCCCTACAATGCCAGTAAACTCTGCCCGCAGGAACGGACCAGCCGGCGGTTCTCCTCCAGGAAAGTTTCCCCGAAAGTTCC
TGCGGCGACCGGTAGCTACCCCATCGCTCAGGTGAACTACGAGCTGAACGTGCTCGGCACCCGCGGGCCAAGGCGGATGCAGTGCACCATGAACTCCATC
CCGACATCAGCGGTAGACCCCGACGGCGTTGTGCCTGGCCAACCGAAGGAGCTCCTCCCCCGGCTATTCGAGGAATCCTTCCGCACCACAGCAAGTTCCA
GGTACTCCACGGACTTCAGCAGCTGCCGCTTCTCCGAGTTTGGGGGAGGGCCTCTGAGAGAAGAAGGCGGCGATGAAAATGCGGGGGACAAGGAGAGCCC
GCTGGTTCTCAAGAACAAATCCGCCTCGGTGGCATGAGCAGCTGCAGTGCTGGTGCCTCAACTTCCGTGGCCGCGTCACGGTGGCCTCGGTCAAGAACTT
CCAG
page-top