Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1994
Contig Information
Length 601 bp
Tissue Liquid cultured tissue
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvs1a05    whvs2i17    rwhvs1a05    rwhvs2i17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27561 [Oryza sativa Indica Group] >gi|125601956|gb|EAZ41281.1| hypothetical protein OsJ_024764 [Oryza sativa (japonica cultivar-group)]
Score 447
Evalue 8.0282e-43
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1994
GGGCAAGGGCCAGCAGCATATGGTCAGAGTGCTCCGGCAGGACCAGGGTACAGTCAACAAGGCGGCTATGCGCAGTATCCTGCATCACAGCCAGCATACG
GTGATCAGTCAGCTCAAAACAATGCAAACTATGGTTATCAGGGAGCCCCAGCTGATCCCAACTATGGAAATGCCTACCCACAGTCAGGATATGCTGCTGC
ACCGACAACTGGTCAGCCTGGATATGGTCAGGCAGGATACACTCAGCCACCAGCTACAAACCCACCAAGTTATGATCAGTCTGCGCCACCAGCAGCTCAA
AGTGGCTATGCTGCACCTGCTGCAAACCCACAGCCTGCGGTTGCAAAGGGCGTGTCACCTCAGCCTGCTGCTGCTGCTGGATACGGCGGGCAGTGGACTG
CCTGACTTCTGTTCCAAAGCCCTGCTGACAGCAAGATATATTTGAAAGCTATATATGTTTTGTCACCTGCTGCTTTAAATCTTTGCGATGTTCCGCCAGG
CTTGCCTTCTAAAAGTTTACTCTCTGTAGTACTAGTAGATTGTTATGTTAACTTTGAACTTCTTGAGTTGAAAAGAGAACCTGGTTAGCTTAAAAAAAAA
A
page-top