Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1971
Contig Information
Length 1442 bp
Tissue Liquid cultured tissue
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvs1e17    whvs17j04    rwhvs1e17    rwhvs17j04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit MBD2 [Triticum aestivum]
Score 1560
Evalue 3.14515e-171
Total Hit Count 262
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1971
TCAGCCCTCTAATCCCCCAACCCATCCGCCGCCGCCGGCGGCGACCACCACCGGAGCTCTCAAATTCCTACCGCCAGCCGCCCGTACCGGCCTCGATCTC
TCCTCCGAGGCAATCTCTTGCAGAACCTATGGACAGTTCTAAATCTCCCCAACCATTGAAGAAGAGCCGTACTAGTTTGTCTGGTACGGATGGCCACCAA
TTTGAGAATGACGAGCTTCAGTCTGAAACTGCATCAGATAAAACACCTGGTTTGAAGTTTGAAACAGTAGATAAAGCGCAAGATGAATTTGGAGAAGACA
GTTCCCCATTGCAGCAATCAGCTGCTTCCAATGTGGCATACCGTGGATCGCCATGTATTGGGGCATTCACTATCCAATGTGCTAGGTGCTTCAAATGGAG
ACTCATTCCAACGAAAGAGAAGTATGAAGAAATACGCGAGCATATTATACAGGAACCTTTTGACTGCGAAAGAGCCCGTGAATGGAAACCTGATGTAACA
TGCGATGATCAAGAAGATATTTCTCAGGATGGAAGCAGACTCTGGGCTATCGACAAACCCAATATTGCACAGCCTCCTGCTGGATGGGAAAGGCAGATTA
GAATAAGAGGTGAAGGAGGCACCAAATTTGCTGATGTGTACTACACTTCTCCTACTGCGAGGAAACTGAGGTCACTGGTTGAAGTTGATCGGTACCTCCA
AGAAAATCCAGAGTATGGTGCGCAGGGTGTAACATTAGCTCAGTTTTCCTTCCAGATTCCTAGACCTCTGCGGCAGAACTATGTCAAAAAGCGCCCTAAG
AACGCAAGTCCAAGTGATGAAGCAACAACTAAGCCTCTTCAACCAGTGGAAGTTAACCCCATATCCTGGGCTGCCCCTCTTGCAAGTGAGGCTAAGGCAA
GTGGACCAGCTTCTCATGCCGACGAAAAGCCAGTTGGATCAGCAGATGTGGAGCTGGTCCGGAAGAGGAAAGCAGAAGGCTCTGAGCCAGGAGAGGCAGA
TGCTAACAACCATGTGTCTGATGCGCCGGAAACCAAGCTAGAGGATGCTCAGAATGGAGATGCTACCACCACTGCCTGAAAAGCTGCAGTCTGACCGTAC
CCAGTGCCCCGCGTCGATGATTTCCTCGACTCTCTATATTCCTTCTCCATTGTATGCGGGAGCCGGTTTTTTCTGTAATGCGAGTCCGTAATGGCCTTAT
ATGTGTACCAAGGCACGAACCTTCGAGGTCGACCCAAAATTCGACGATTTGGGACAGCAAGTTGACTGAATGTTGTAGTATCGTGGAAGCCCTGTCGAAC
CCTTTCGGAGCATGTATGTTCCCCTACGTGCTTATGTAGGAGACCTTGTCGTGCAAGATTAGATGCCTTTAATTTTCTCCTTTGTAAGATACAGAAATGT
CGGTAGGGTACTGTTGTGTTGTGCCTGTATGTCGGAGTCGAC
page-top