Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1970
Contig Information
Length 687 bp
Tissue Liquid cultured tissue
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvs1d20    whvs12a06    rwhvs1d20    rwhvs12a06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutamine synthetase isoform GS1b [Triticum aestivum]
Score 581
Evalue 3.13537e-58
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1970
TGGTGCTCACACAAACTACAGTACCGAGTCGATGAGGAAGGACGGCGGGTTCAAGGTCATCGTGGACGCCGTCGAGAAGCTCAAGCTGAAGCACAAGGAG
CACATCGCCGCCTACGGCGAGGGCAACGAGCGCCGTCTGACCGGCAAGCACGAGACCGCCGACATCAACACCTTCAGCTGGGGTGTCGCGAACCGTGGCG
CGTCGGTGCGCGTGGGCCGGGAGACGGAGCAGAACGGCAAGGGCTACTTCGAGGACCGCCGGCCGGCGTCCAACATGGACCCCTACGTGGTCACCTCGAT
GATCGCCGAGACCACCATCCTGTGGAAGCCCTGAAGCCGATCAGCGCCGATCGCCGTGCGATGATCAGTGGTGGGTTGGGTTTGGTGGTGGCCATTGGAG
GATTTGGACGAAATTCTTCCAAGATATTTCCTTTTCCGTTTGGTTGCATACTACGCGTAGTCCGTTTAGGTAGGTCACATCATCGTCGTCGTCATCAGGG
TGTCTGGTCTCTCTTCTCTCGTCTTTGGGTGGTGGGTGGCAAGAGGCGTGTCAAACACACAGGACTACTATTGATTGTTTTCCCTTGCCGTCTGGGTGCT
CTGGTCTCGTCTCGTGTAATCATCAATTGATATGGTAATAAAATGGTCCGTACCGCAGGCCGTGGTACCACGCAACGCCGCTTGTCT
page-top