Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1931
Contig Information
Length 995 bp
Tissue Liquid cultured tissue
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvs1a15    whvs1a16    rwhvs1a15    rwhvs1a16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 394
Evalue 2.95768e-36
Total Hit Count 108
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1931
CTTGAAATTTTTTCAGGAATGACACAAAGTACTAGATAATAATTCACGAATTTTAAGGAAAAAACATGAAACACACAGGTAATCAGCAAAATAACACTTC
AACCCACTGACAGACGCTAACCACAAGTTATACATATCGATTCACACAAATAACATAGCACTACAGAGGTGTGCTAATCATGGTTTTAACAACAAAAATA
CAAACTACGGCTAGAAATCCAGCAATGATAAGCATTTTGTTCCATAAAAAATGCCCATGTGTGACTGATCCATAGCAAAATGTTTGTTGTTGAAATAGTT
ACTCTACTAAAACTTCCACCATCAACTTCTTTGAACATTTTTATCGGATAGCTTTAGTAAACCTTATGCTATCTACATCTCAGAAATCTCCTCCTTCAAC
CAATAAAGTCGAAGATTTGAGTCCTTGGTATTGATGAATATTTCTCGATTCATTGGGCATTTGAAAAGCCGCAGTGCCTTTGCTTTTTCTGCAACTGATA
AATCTTCCATTGGTTCTAGCGCAGCCACACAGTTTCCAATCGAGAAAATGTCATCTTGCTTTGATTCCTTCAACTCGTCAACCAGTTTTGCAGACTGTTT
CTTCCGAAAATCCATGTAATCCTCAAGTACAACAGCGATCTGACTTTGCTTCCTCTTTTTGACAGGCAGTGCTCCCTTTTGTTCAGAGTTGGTAGATGTT
GTAGCTTCAGGTTCATCTCTTCTTGATGCCCCTTGCCCTTGTAGATCAGATGAGGACATACCATCATCAACATTGGTAGAGGAGATATAGTTCAAATCAT
TAGTAGAGGAATCCATAGGAGAAATGGCATCGCTTGTGAGATCCACTTGCGGAATTGATACAAAGTTCAAGTCTCCTGAAGCAATACTTCCTTCATGTAG
TGTAGCCAATGACTTGAAGAGCATGAATGGTTTTGAACGGAACTTCTTTACCCTTAGATTATCCTTGATAAGTTTATCCCATATTACAGGTCAGC
page-top