Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1927
Contig Information
Length 1196 bp
Tissue Liquid cultured tissue
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvs1e04    whvs4n23    rwhvs1e04    rwhvs4n23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_18349 [Oryza sativa Indica Group]
Score 1169
Evalue 5.30615e-126
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1927
TTTTTTTTTTATGTAAGCATGTGTATTATTTTATTGTCGTTTTATTTTGCAGTGAGTATTGTGGTAATACAAATTAGGCATGGAACAGAGCCTTCAAATT
AAATACAAATCATTACATCCATGGCACCTGTGTAGGTGTGATGCCGCTGCTTCTAGTAATAGTAGTTCTGGTTGGTGACTCTGCAGTTCTTCCTTATCTC
GTAACGGGTACTACCCTCGGCCGGGAGCTTGCTGAGCTTGACCATGGCGGCGGCGAAGTCGTTGTTCCACTTGGTGGCATTGTTCATGTACTCGGCCATA
TCGTCCCCAGCTTTGCTGTCGGTGCGCATAACCCAGTCGGACTTGAAGAGCACCCTGTTCTGTAGGTTGGCGTGGTAGTAGCTGTTGTCCAGGGCGCCCT
TCGCCGCGGTGTTCACCCCCGTGGTGTCGTAGCCGGAGTCGTTCTGGAACTTCAAGCTCATGTCGCGGATGTTGTTCTTCTCGATCGGATCCGACGTATT
TTGGCTCTTCTTCTGATCCTCGACGTCCTTAACGAGCGCCTGCTTGTAGCTGTCGTCGATCGGGGTCGCGGTTGAATCGTTGAGGCGGTCCTGGAAAGAC
GAGAGGTGGGAGACGCCGATGGAGTGCGCGCCGGAGAGGATGACGAGCTCCTCCTGGGTGAAGCCCTTGTTGGCGAAGTTGTCCTTGAGCTGCTGGAACT
CAAAGGTGGATTGCGGGAAGATGGCGTCTGCGGTAGCATCCGACGAGACAATGCCGTCCTTGCGCCCTGAGGGAACGGAGTAGGCGATTTTGCCGCCGCT
CAGGTATCTGGCCGCGTCACGCGCGGCGAAGACGACAATGTCAGCGCACGAGACGCTGTTGCCCAGTTTGTACTTGATGGTGTCGATCAGGTTGAAGCCG
TCCAGGCCGATGTTGTTGATCGCCTTCTTCTCGGTGTTGCCACCGGATGGCGTCTTGTCCAAGAGCACCGATCCATCGCAACCATTAACCCAGCAGTCGT
GGAACACCAGCCGGACGAGGGCCGCGCCGATGCCGGGGTTGCCCTTGATGGCATTCTCTACTTCTTTCCTTACGGTGCCCTCCACGTCCACGTAGGCGGC
CGCCGATTGCCCGGCAGAATACGCCAGCAACAGGCACAGAGACAACAGGGCGGCGCCGGCGTTAACCTTGGCCATCTTAAGCTTCAGCTCGAGCTC
page-top