Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1305
Contig Information
Length 861 bp
Tissue Callus
Clones 3 Clones [Download: CSV  ,  FASTA ]
whcs10b22    rwhcs10b22    rwhcs11a10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit transposase [Secale sylvestre]
Score 98
Evalue 0.0490546
Total Hit Count 36
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1305
AATAGTTGGCTTCAATCGCCACTTCACTCAAATACAAGTTAAACATACATCATCCAGAATACAATCAAAGGTCCGACTATGGAACCAAAATAAAAGAAGA
CAACCCCAAATGCTAGATTCCCGATCATCCCAACTGGACTCCACTACTGATCAACTGGAAACGAAACAACACAACGAACACGATCTTCATCGAGCTCCCA
CTTGAGCTCAGTTGTGTCATTTGCACTGGTATCATCGGCACCTGAGATCCCGCAAGGAAGTAGAACGAGTCCATGAACAAGACAAACGGACGTAGTCGAA
CGGATCCTCACAAATGCGACGTTATCAGAAATCGGGCCTAGCAGGCCGAAACTGAAGCTGGGCCAGAGAGGAGGCGCACTGGGCCAAAGAGGAATCATCG
TGGGCCGACCGGATCTGACCAATGCGGTCAACGTGGTTGCTGAGCGTTCATCGTCTCGTTCCTGAAGCAGGGACTCAGCGATGCAGGGGAGCTGGCGCGG
TCAACGCAGAGGAAACAGAAGCCTTGGCGCGGCCGCGACGCAGAGGACGCAGAGGCGGCCTAGCATTGCTTTGGACTCCGGCGAAAAACGGCGCGACGGG
GAGGTGGAAGGCGCTGGTGACCCATGGCAGCAATGAAGCAGAGGATACGAGCGGACACCGGGGTGCTCCGACGAGGTACTTGGTAGGGCAGCAGGGTCTA
GACAATGGGAACGAGGCCTAGACGACGGGAACAACGCAGAGAAGGTCGCTGGCGGCGGGGCTCCTCCTGTTAACGAACGAAGACAGAGGGAATGATGTGA
GAGCGAGCGAGAGAGAGAGAGAGAGGAAAACATGGGGAAGGAGGACAAGAAGGGCGACGGA
page-top