Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1901
Contig Information
Length 632 bp
Tissue Liquid cultured tissue
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvs1a14    whvs17a08    rwhvs1a14    rwhvs17a08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.9 >gi|152032521|sp|A2Y7R3|H2B9_ORYSI RecName: Full=Histone H2B.9 >gi|50080248|gb|AAT69583.1| putative histone H2B [Oryza sativa (japonica cultivar-group)] >gi|52353547|gb|AAU44113.1| putative histone H2B [Oryza sativa (japonica cultivar-group)] >gi|125553414|gb|EAY99123.1| hypothetical protein OsI_21083 [Oryza sativa Indica Group] >gi|125595303|gb|EAZ35362.1| hypothetical protein OsJ_018845 [Oryza sativa (japonica cultivar-group)]
Score 469
Evalue 2.52762e-45
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1901
ACCTCCACACGTTCGAACCACCACCACCAGAAGCAGCACCCATGGCACCCAAGGCGGCAGAGAAGAAGCTGGCGCCGGCCACGGCAGAGAAGACGACGGC
GGGGAAGAAGCCCAAGGCGGAGAAGCGGGCGCCGGCGACCAAGGAGGCCGGCGGCGAGGGCAAGACGAGGGGCCGGAAGAAGGGCAGCAAGGCCAAGAAG
GGCGTGGAGACGTACAAGATCTACATCTTCAAGGTGCTCAAGCAGGTGCACCCGGACGTCGGCATCTCCTCCAAGGCCATGTCCATCATGAACTCCTTCA
TCAACGACATCTTCGAGAAGCTCGCCGGGGAGTCCGCCAAGCTGGCGAGGTACAACAAGAAGCCCACCATCACGTCCCGGGAGATCCAGACCTCCGTCCG
CCTCGTCCTCCCCGGGGAGCTCGCCAAGCACGCCGTCTCCGAGGGCACCAAGGCCGTCACCAAGTTCACATCATCCTAGGCTGGCTTCGTCGTCGTCGTT
TCATGAGTTGATGGCGGCAGGCATCGTGTATGTAGTTGGCAGTAGTATGATGTTACAACCTTTGTAAGAATTGTGCTGCTTGCTTGTGGGACTGAAGAAA
CAGTGATGTTGCTGTTTAAATCAAAAAAAAAA
page-top