Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1864
Contig Information
Length 842 bp
Tissue Liquid cultured tissue
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvs2o08    whvs3g06    rwhvs2o08    rwhvs17g05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0519900 [Oryza sativa (japonica cultivar-group)] >gi|49387779|dbj|BAD26337.1| putative elongation factor 2 [Oryza sativa Japonica Group] >gi|113536503|dbj|BAF08886.1| Os02g0519900 [Oryza sativa (japonica cultivar-group)] >gi|119395216|gb|ABL74569.1| elongation factor 2 [Oryza sativa (japonica cultivar-group)] >gi|125539668|gb|EAY86063.1| hypothetical protein OsI_07431 [Oryza sativa Indica Group] >gi|125582310|gb|EAZ23241.1| hypothetical protein OsJ_006724 [Oryza sativa (japonica cultivar-group)]
Score 1133
Evalue 4.55195e-122
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1864
TAAGTAAAACATCCGTTACATCACCAGACATCTCAAAACATAGTTCCCAGTATCACGACAAATAGGTCATTAACAGCAAGACTCATCGATACAAAATAGT
GCGGCTCTCTTTAACAACACAAGACCAGGTAAGGGATAACAGCACCAAAAATTTAGAGCTTGTCTTCGAAATCGGATAGAGGGGTCATCTGCTCCTTGAG
CCCCTTCCTCTTGCGGATCTCCGTGACGAGCGTCGCAGACTGGGTGCCGGGGTCCAAAGGATCGGAAGCCATGATGTCCCAGTGGTCAAACACACACTGG
GGGAAGGCCTGGCCGGACGTCGCAGCCCTCAGGGTGCTTGAGAACCCAAAGGACTCGATGACGGGGAGGTAGGCCTTGATGTTGTAGAGCGGGGTACCTT
GCCTCTGCATCTCCTCGAACACGTGCCCTCTCTTCTGATTCAGAACACCATAGATGCCACCAAGCGCATTCTCCGGGGCCTGGATTTCAACCAGGTACAC
AGGCTCCAGCAGCCTTGGCTTGGCAGTCAGCTGAGAAGCATAAATGACCCTCCTGGCCGTGGGAATGACCTGACCACCACCCCTGTGAATAGCATCAGTG
TGGAGAACAACATCACAGACCTCGAAGCAGATGCCACGCATGTTCTCCTCAGCCAGTGCACCTTCCTTCGACGCCCACTGGAACCCAGCCACAACAGAGT
CCTTGATTTCATTAAGATACTGCACTCCCTTACACATGTCAACAACCATGTTGGGGCCAGTCGTCTCAGGTCCAAAGCACCAAATCTTCTTGGCAAGATC
CTTGTCCCACCCAAACTCCTCAGACAGGATCTGGACCGCACC
page-top