Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1825
Contig Information
Length 814 bp
Tissue Liquid cultured tissue
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvs1a10    whvs18i23    rwhvs18i23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutathione s-transferase gstf2 [Oryza sativa (indica cultivar-group)]
Score 670
Evalue 2.08294e-68
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1825
GGCCGTCAGTCAAACCGCTCTCCTGCAATCACGGGAAGGGGATCCATCATCCATGGCCATGGGGACGGAGGCGAAGGCGAAGGTGTTCGGGCCGGCGAGA
TCCACCTGCGTGGCGCGGGTGCTGGTGTGCCTGGAGGAGGTCGGCGCCGAGTACGAGCTGGTGCACGTTCACCTCCCCGCCGGCGACCACAAGGGCCCCG
CGCATCTCGCTCGCACCCCCTTTGGTCAGGTCCCGGCTTTCCAGGACGGCGATCTCATCCTTTTCGAATCGCGTGCGATTTCGAGGTACGTGCTCCGCAA
AGGCGCATCCGATCTTCTAAGGCAGAGAAGCCTCGCCGAGGCGGCGGCGGTCGACGCATGGCTCGACGCCGAGGCCCACAACTTTGACAGGGCCATGTCG
GCGATCACCTTCCAGTGCTTCGTCGTACCCATGTTCATGGGCGGGATGACCGACCAGAGGGTCGTCGAGGAGAACCTGGAGAAGCTTAAGGTGGCCCTCG
GAGTCTACGAGGAGCGTCTGACCAGGTTCAAATACTTGGCCGGAGATTTCATCAGCCTGGCGGACATCAGCCATTGCCCCATGGCTCACTACCTGCTGGC
CAGCCCCTGCGCGTCGGTGCTCGATGCGTATTTGCGTGTGAAGGCCTGGGTTGATGGGATGATGGATCAACCGAGCGTGAAGAAGGTCATGGAGCTTATG
GATGCGTCATGAAAAGAGTGGTGTGGTGTGTGCTTTGTGGAGACTATGTGAGATGTGCTGGTGCAGATGATTTGTCTTGTTTGTAATAACTCTTTCCATT
TCGAGAGAAAAGTT
page-top