Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1769
Contig Information
Length 707 bp
Tissue Liquid cultured tissue
Clones 3 Clones [Download: CSV  ,  FASTA ]
rwhvs7n23    rwhvs14j17    rwhvs14j18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_16154 [Oryza sativa Indica Group]
Score 737
Evalue 2.69668e-76
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1769
TTTTTAAGCACCGATAGCCGCTCTGGCCTCACGGCATAACAGTACCCAGCCCCACGAATCGCGCCACCTCCAAATCCAGAGTGAACACATCTAGTACGAT
CCATTAACCAATGGTAGCACTACTACTACCGTAGCAGCCATAGTCCAGCCTAGCTAGAAGGAGAACGTGAAGCGCATGTCGTGTTTGTACACCTGGCCGG
GCCTCACCGTCACCGACGGGAACTCGGGGTGGTTCACGGCGTCCGGGTACGCCTGCGTCTCGAGGCAGAACCCGCCGTACTGCTCGTACAGCTTGCCGCC
CTTCCCCTGGGTGTGGTTCAGAAAGTTGCCGGTGTAGAGCTGCATGGCCGGCTGGTTGGCCCACAGCTCCAGCGCGCGCCCGGACTTGCCGTCCCGCGCC
ACCGCCACCTTCCGCATGCCCTCCCCGTCGATGACGTAGTTGATGTCGTACCCGTAGACTTTGCCGCCCATGACCTGCCTGATGCGCGCGCCGATTGGCA
TCGGCGTGCGGAAGTCGTANCTGGTGCCAGCCACGGGGTCGACGCGGCCGGACGACNGGAGCATCTCCCCGTCCAGCGGGGTGTANCGGGACGCGGANAG
CTGGANCGTGTGGCCCANGATGTCNCCNCTGCCCTCCCCNNCCANGTTCANGTACACNTGCTGCAANGAANTTCANCGGCNTCNCCTTGTTNNNCNCCGN
NNCNTTC
page-top