Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1755
Contig Information
Length 1126 bp
Tissue Liquid cultured tissue
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvs1a17    whvs14g20    rwhvs14g20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative beta-expansin [Triticum aestivum]
Score 1396
Evalue 2.30442e-152
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1755
AGCTCGCAGCCTCTAAATTTTCAAGCTCCTAGTCCCAGTGCTTGCTAGCAAGCTACAAGCAGCAGCAGCAGCAGCAATGGCGAAAACTTGCACCCTAGCG
CTACTTGGCGCACTGCTGGTGCTCTCGCTTCTTGTGAGCCCAATTGCTTGCTCCCGCAAGCTCGCCAAGGTGGGCGGGCACGACAAGTCTGCTCCGGTCA
AGGGCCACAAAAACCAGACCACCACTAACCCCTCCTCGTCCGCCGCATACGGCGGCGGCTGGTTGCCCGCCGGCGCCACGTATTACGGCAACCCCAACGG
CGACGGGAGCGACGGCGGAGCGTGTGGCTACCAAACCGCTGTTGGGCACCGGCCGTTCTCGTCGATGATCGCCGCAGGGAGCTCGCCTCTATTCATGGCG
GGCATGGGCTGCGGCGCGTGCTATGATGTTAAATGCACGAGCAACTCAGCCTGCTCCGGGAAGCCTGTGACCGTCGTCATCACCGACCTGAGCCCCGGCA
ACCTCTACCCCGGCGAGCCGTGCCATTTCGACATGAGCGGCACCGCCCTGGGCGCCATGGCGAAGCCTGGCATGGCCGACAAGCTCCGCGCCGGCGGTGT
CATCAGGATGCAGTACAAGAGGGTGCCATGCAAGTACCCTGGCGTCAACATTGCATTCAGGGTGGACCAGGGCTCCAACCCCTTCTACTTCAAGACCTTG
ATCGAGTTCGTGGGCGACGACGGTGACCTCAAGGCCGTGGCCCTCAAGGAGGCTGGCAGCGGCGCCTGGACGCCAATGGCGCAGGACTGGGGCGCACTGT
GGCGCCTCAACAACGGCAGGCGGCTGCGCGCCCCATTCTGCCTCAAGCTCACATCCGACTCCGGCAGGGTCCTCGTCGTCAACAACGTCATTCCCGCCAA
CTGGAAGGCCGGGGCCACGTATCGCTCCCTGGTGAACTACCGCTAAGTTACAGCCATATTTATCTGCTCCGTGTGTGAATTTTGTACCTCGAAAAGAAAG
AATGTGCGTCCGGGTGCTGCGAGAGGCGGTCTCGGATGAGGAGGAGCTTACGGAACTGTGATGTTCCCTCCCTGGTCTCTGCATTCCCCTAGTGATGTAC
GTATCATGTGTGTAGTCCGTCTGTCT
page-top