Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1745
Contig Information
Length 992 bp
Tissue Liquid cultured tissue
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvs1a11    rwhvs1a11    rwhvs16p17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_05861 [Oryza sativa Indica Group]
Score 947
Evalue 2.21165e-100
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1745
AATAGTCAGGTTACATGCATTTACTGCTAAAAATCACTAGCATGAAACACCAGCATAGAAGCTACACAGTACAAGGTTCAGCATGAAGAAAGAAAAAGTA
CCCCTTGGATCATATGGTAACAACACTGCCTCACCATCCCCCTGTGTTCCGACATTACCTACCATCTAGGATAGCCGGGAGCATGGAACAACGACGAAAC
TCAGGCCAAGTCAGTTTGGTTTCGCAGCACGGGAGGGCGCCGCCACATGACATCTACTTCGAGCATCAGATACAACAGCAGATACAACGCCGTGGAGGAA
CAAGAACTATGAAGATTGGTCCTTGGCGGCCTCCTCACTTTGGTCCTTGGCGACCTCCTCACTTGGTCCATCTCCGGCAGACGTCGTCGTTCCGTCCAAG
AAGCGAACAATGACGACAGTGATGTTGTCAGCACTGCCCCTTTGAGAAGCTTCTTGAAGTAGTCCCTTCGCCGCTTGCTCAGGATCTTCTATTGGCTTGA
CCATGGCAACAGCTTCATCGTTAGTTACAACATCCCATAGCCCATCACTAGCAAGGATAAGGAATTCAAGTGAGCTGTCAACTACCTCCTCCTTGATCTC
TGGATCAGCGACAACATACTGCTTTAAAAGTTTGTCACCAAATGCTCGAGAAACAGCAAGAACACCACCAACACGCCATGTCCCAGCCCACATCACAAAG
CCTCCAGCTTCCTCAATTCTCTGTCTCTCGTCTGTCTGGTCAGGTTTGTGATCCCTGGAAACCGCAATAGCCTTCCCTCCTTTAGAAACAACAGCTCTAG
AATCACCAACATTTGCAACCACCAAGCGACCACCGACAAGAATAGCTGTTGAGGCAGTTGAGCCAGCATCTCTGGTGTGGCTACTATCAGCTTTCAGGAA
CTCTGAATCGGTATGATTGAATGTTTCAGCAATAGCAGCCTTTGTATNTGTCATGAATTTCGGATGCTTGATTAAATTGCTGAAAAGGTGCT
page-top