Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1673
Contig Information
Length 949 bp
Tissue Liquid cultured tissue
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvs7m08    rwhvs1b05    rwhvs7m08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100194331 [Zea mays] >gi|194695542|gb|ACF81855.1| unknown [Zea mays] >gi|195624594|gb|ACG34127.1| ras-related protein RIC2 [Zea mays] >gi|195643338|gb|ACG41137.1| ras-related protein RIC2 [Zea mays]
Score 1057
Evalue 3.60687e-113
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1673
GCCGATTGCCTCAAAGACCATACAACAATATGAAGGAAGGTCTCACCCTCATCTAGACAAACTTCCCGGTTCAGCAACAAACTTCAACTTCTCTAGGTAA
CATTCATAATAATAATACTTGCTACTACTGCTACTAATAATTCCCGGTCGCTGGAAATGCCACATCACAAAAGCTCAGCAAAAAGAATGCATCATGGCGC
CTCAGCTAGAGCAGCACCCACCCTTCTTCACCGCCGAGACATCGTCCTTCATGTTGATCTTCTCACCCTTGCCAGGGCCGGCGGCCGACTCTTCGCCTGC
CTCGACCGCCCTCTTGCTCACGATGCGGTAAATCTGTTTCAAGACCTCCGCAAACGCGTCCTCCACATTGGTCGACTCGAGCGCAGAGGTCTCCATGAAA
TAGAGTGACTCCCTCTCTGCAAACGACTTCCCTTCGTCGGTTGGGACTGCCACGAGATGGCGGAGATCGGACTTGTTGCCAACAAGCATGACAACTATGT
TCGGATCTGTATGGTCCCTCAATTCCTTCAGCCAGCGCTCTGCATTCTCGAAGGTTGCGTGCCGAGTGACGTCGTAGACGAGCAACGCTCCTACAGCACC
ACGGTAGTATGCGCTAGTAATAGCACGGTATCGTTCCTGGCCAGCGGTGTCCCAAATCTGGGCCTTGACGACCTTGCCGTCGACCTGGAGGGAGCGGGTG
GCGAACTCGACCCCGATGGTGGACTTGGACTCGAGGCTGAACTCGTTGCGGGTGAAGCGGGAGAGCAGGTTGGACTTGCCGACGCCGGAGTCGCCGATGA
GGACGACCTTGAAGAGGTAGTCGTAGTCGTCCTCCGCCCGGTACCCCGCCGCCATTGCTCCCGTCGCGTCGGCGATCTGGTTGTGGGGGGTGGCGAAGGA
GGAGAGCGAGGGGGGAAGGGGAAGGTGGGGGAGGTGGTGAAAAGCGGGG
page-top