Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1669
Contig Information
Length 705 bp
Tissue Liquid cultured tissue
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvs2a17    rwhvs1a10    rwhvs2a17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera]
Score 638
Evalue 8.13834e-65
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1669
AGCTTCAGATAGGCACCAACCAGGTGGATGATTTAGGACGACCAACGAACAAATGATCCAGCTCCACGAACATAGTATTGCACAGAGTACGCTACTGACA
TATTACTACACACGACCAGTATTAGTAGTTCACGACACATGACAAGTGTTCAGCAGCAAAAGCAGACGCAGATGCCCACCAGAGCCATTCCCACAGGCAA
AGCAAGCACCTTAAGCCCTCTCGCCACGGATCCTCCTAGCCAGCTGAATGTCCTTGGGCATGATGGTCACGCGCTTGGCATGGATGGCGCACAGGTTGGT
GTCCTCGAAGAGACCCACCAAGTAGGCCTCTGCAGCCTCCTGAAGGGCCAGCACCGCATGGCTCTGGAAGCGGAGGTCAGTCTTGAAGTCCTGGGCAATC
TCCCTAACAAGCCTCTGGAAAGGAAGCTTCCTTATGAGCAGCTCAGTGCTCTTCTGGTACTTGCGGATCTCACGAAGAGCAACAGTTCCAGGGCGGTAAC
GGTGAGGCTTCTTCACTCCTCCAGTGGTGGGAGCAGACTTACGGGCAGCCTTGGTGGCCAACTGCTTCCTTGGAGCCTTTCCTCCAGTGGACTTACGAGC
AGTCTGCTTAGTACGAGCCATGAGCACCAACCTTGGTTTACCTCGCGCGCCTCAGAAACCCCAAATTCGCCGAGAGGGAGAGGTTGCAACTTTCAGGGGC
CTCGG
page-top