Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1668
Contig Information
Length 1483 bp
Tissue Liquid cultured tissue
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvs1f13    whvs7l22    rwhvs1f13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_033519 [Oryza sativa (japonica cultivar-group)]
Score 1821
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1668
TGATGTCTCTCTTCTCACCATTGAAGAGGGCATCTTTGAGGTCAAGTCCACTGCTGGTGACACTCACCTTGGTGGTGAGGACTTTGACAACAGGATGGTC
AACCACTTTGTCCAAGAATTCAAGAGGAAGAACAAGAAGGATATCAGCGGCAATCCCAGGGCTCTCCGTAGGCTGAGGACAGCTTGTGAGCGGGCGAAGA
GGACCCTCTCCTCCACTGCGCAGACCACCATTGAGATCGACTCGTTGTATGAGGGCATCGACTTCTACACGACCATCACCCGTGCCAGGTTTGAGGAGTT
GAACATGGACCTCTTCAGGAAGTGCATGGAGCCTGTTGAGAAGTGCCTGAGGGATGCTAAGATGGACAAGAGCACTGTCCATGATGTTGTCCTTGTTGGT
GGCTCCACCAGGATCCCAAGGGTGCAGCAGCTGCTTCAGGACTTCTTCAATGGCAAGGAGCTGTGCAAGAACATCAACCCGGATGAGGCTGTTGCCTATG
GTGCTGCAGTCCAGGCAGCCATCTTGAGTGGAGAGGGCAACGAGAAGGTCCAGGACCTCCTGCTGCTTGATGTCACGCCTCTTTCTCTTGGTCTGGAGAC
TGCTGGAGGTGTCATGACCGTTTTGATTCCAAGGAACACCACCATCCCCACCAAGAAGGAGCAGGTCTTCTCCACCTACTCTGACAACCAGCCTGGTGTC
CTTATCCAGGTTTATGAGGGTGAGAGGACCAGGACCCGCGACAACAACCTGCTGGGCAAGTTTGAGCTCTCCGGCATCCCTCCTGCCCCCAGGGGTGTGC
CCCAGATCACGGTCTGCTTCGACATTGACGCAAATGGCATTCTGAACGTCTCTGCGGAGGACAAGACGACTGGGCAGAAGAACAAGATCACAATCACGAA
TGACAAGGGCAGGCTGAGCAAGGATGAGATCGAGAAGATGGTGCAGGAGGCAGAGAAGTACAAGTCAGAGGACGAGGAGCACAAGAAGAAGGTGGAGTCA
AAGAATGCCCTGGAGAACTATGCCTACAACATGCGCAACACTATCAAGGACGACAAGATCGCCTCCAAGCTAGCTGCGGACGACAAGAAGAAAATCGAGG
ACGCCATTGACCAGGCCATCCAGTGGCTGGACGGCAACCAGCTTGCTGAGGCAGATGAGTTTGACGACAAGATGAAGGAGCTGGAGGGCCTCTGCAACCC
CATAATCGCCAAGATGTACCAGGGTGCCGGAGCTGACATGGCGGGTGGCATGGACGAGGACGATGCGCCTCCGGCTGCCGGCGGCGCTGGCCCCAAGATC
GAGGAGGTCGACTAAGCGAGCACTTGTACCAGTCTTTTACCCTAAAGTTTATCCCGTTCGTTATGTTGGATGCTACTGCAGTACGTGGTGTTGGATGTGA
GCTTTGTGTGTGTGAACTGCGTTTGCTGCTGCCTGCTTTTCTGTTAATGTTAGTTACATCTGGTGATATGCTGCTATTGCTCT
page-top