Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1661
Contig Information
Length 1431 bp
Tissue Liquid cultured tissue
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvs1d02    rwhvs1d02    rwhvs16e10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_18782 [Oryza sativa Indica Group]
Score 1239
Evalue 5.19853e-134
Total Hit Count 376
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1661
ACTTTGAAAGATGGCCAGTACAGAATGATCTTATACATCAGGAAGAGGCGAAGAGATATGCCATGTCCAGTTGTCCACAAGGAGCAACATGCTCATAGAA
ATAAAAGAAGAAAGAAATTTACTCTGCCTTCTAGAAAAAATCATGCCATCTACAATACAACACTCTGTTAATATCTACTCTTGTCAGCGCCATTGCTTCG
CAATCTCCTCATCAAGCATATGGGTGGCCTGCTGCCTGGACCTATCATCCAGATTGGTATTGCTTGCCAATAAACTTCGTAGGGCTCGCAGTTCATCCAG
GCTAGCTCTCTGGAAGAGCCCCCTCAGGACAATACTTGGTGGATTCTGAGGTAGGGTATGTTGATTACTAGTGGCAGCATGAGGCCTGTATCTCCAGTAC
TCTGTACAGATGCGATCTCTATCCCGAGCCTCAATTGCCCGAACTATTTCTGGTGATAAGAGCCCAAACATTTCAAGACCATCGATAGATCCTGGAGGCT
GCAGTGTAGGAACGTTAGGCCTTCCCATACTGAGTTGCCTCCGTATTTCCATGTTCAGCCTCTCTCTGACCATGTTCCAGCACTTGGTAGGCGACTCATT
AATGAAAACTTCACCTGGGCAGTTCTCTACAGTAACCATAAATAGAGGTCCTTGCAACCCAGCGTCTAATATTTCGGAAAAGTAGTATGCCATTTGAATT
GGATCCACGATGCTCCAGTATTTTACTCTGCTCCTAAATCCTTTGGGGAAGATTGCTTGGCCTGAAGACCACATTCTCCCTGATAACACAGTACCAATTT
CCAGAGGTTCAACAGAGCATTTGAATCGATGCACGACATTTGCTATGCGAGGACCCCTCTGTGGACCTCCATTCCTGTTGTGCATTTCCAGAGCAGGGTG
TGCTATGGCGGGTGGATGGGCATGTTGTGCTACGGCAGATGGATGGGCATGTTGTGGTGCAACAGATGGATGGGCATGTTGTGGTGAGACAGATGGATGG
GCATGTTGTGGTGCGACAGATGGATGGGCATGTTGTGCTGCGACAGATGGATGCCCCCTGGCTCTAACCTCTACAGTAGATTGAGATTCAGGTTTTCTTT
GAAACCATCCATTGTTTGGTTGCTGATTGAAAGTTAAATTTCCATGATGGGCACTGGCTGAAGGAAAACGCCCGTGTGGATTTTGAACACTAGAAGGGTC
TATGGGAACAAAGACACTGCTTGATGCTTCCTGTGACACACTTGGTGTCCGTGAAACATTTTGGTTAAACTGCTGACTCGACACAGTACGGAGCTGGCTG
TTGCCTTTCTCAAGCATTATTGTGGCATTAGTCTCTGGTGTTATAAGCGCATGATCCTTGTCCGAGTGACAGAGAGTTGCATTAGAGTCGGATGCAATCA
ACCTGTGAGAAGTGTTTGAGCTATCTAAACT
page-top