Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1648
Contig Information
Length 1196 bp
Tissue Liquid cultured tissue
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvs6b22    rwhvs6b22    rwhvs7h11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_025048 [Oryza sativa (japonica cultivar-group)]
Score 1011
Evalue 1.11154e-107
Total Hit Count 307
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1648
CAATTTTATCAACTCGATATATTTACAAGTACAAAAGGGGATCAAGATGGCCAGCAGATAGACTCGGATCTCATCTTGTAGAGGGAGATTTTCTTATATC
TACCCTAAACAGCAATCACATGCGTACAAGCTTAAATATGCAGTGATACAAGCAAACACAGGCCCAAACTTATTGCCCAATTCGTATTTACAAGGCACTA
TAGAAAAGAAATTATATGTGGGCTCAGAAACTTTTGCTGTTTTCACCTCCATCTTGTCTAAATAAAAAATCTGGACATAACTTTTCTACCCTCTGCTAGT
CATTCCTGGAGTTTGTACGGAGCAAGTCACTCGGAAACCCCATCCTTCAGCTTATTTCAGACTCGTACTGATGTCGACCAAGAAGGTGATGGAACTACAA
AAATTGTTTCCAATGCATAATACCACATCGTGAGCGCGAGCAGACCATACTTACAATCTTATACTTGATCTGAGCAGGTAGTTTGTGCATTGGCGACAAC
CTTGCTCACATTGGAAGACAGCTTTCCTCTTAGCTCAGCACAGACAAGATGTGTCAAGAGGAGCCCAGCAAGAAGTGCTGCTGCCATCAACATCGTGAAC
ACGGCACTCCAGCTCTCTGTTGAGATGTATCCTGTGAGCAATGGCCCGATTGCGGCACCAACCGACCCGGTCCCATCGATGATTGCTGTCACAGTGGCCA
GTGCCCGAGAATTACCATTCAATGAGCTGTGAGTGCCAAGGTCAGCTGACACTGCAGTTGTGATCAGGGCATAAGGACCATTGACAAACATGCCAGTGAT
GAACATGAGGCAAATGTTCGACATCATCGACATGCTTCCATATGTTCTGTACAAGAAAAGGGCAGGTATGGCACAGTACATGAAGCTCGCGGCCGTGATA
GCTCGTGCATTTAAGCGATCAGAGATATGACCGGCAAGGACTCCTCCCAACACACCTCCAACATCGAAGACTGTTGACAAGCTGCCAGCCATCGCATCAG
AGAGGTACTCGTTGCCAATAGGTGTATGGCTGATGTAAAAAGGTAGCCAGTACAGGAAGGTGTATGCAACCAGCTTGGAGAAGAAGAGGCAGAGAGCAAA
CGGTGCAACTCCAGGAATCCTCCATGCCTCCAGGAATCCTATTGCCTTATGTTTCACTTCTTGGCCTGGTTCCAAAAGGGGCTCCTTCGCAGTATC
page-top