Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1656
Contig Information
Length 643 bp
Tissue Liquid cultured tissue
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvs1e05    rwhvs1e05    rwhvs6f03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.2
Score 447
Evalue 9.32292e-43
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1656
CATATCCTGAAACATTTGTGCCCTCACAAATTACAAGATGCTGCGCTTCTGAACATCTAACTACAGAGCACAGTGGATTCATCAAACACCCACGAGATGT
CAACACATTCAGAGAAGACACAAGAGCAGGCTATCTAAGAGGAGGTGAACTTGGTGACTGCCTTGGTGCCCTCGGAGACGGCGTGCTTGGCGAGCTCGCC
GGGGAGGACGAGGCGGACGGAGGTCTGGATCTCCCGGGACGTGATGGTGGGCTTCTTGTTGTACCTGGCCAGCTTGGCGGACTCGCCGGCGAGCTTCTCG
AAGATGTCGTTGATGAAGGAGTTCATGATGGACATGGCCTTGGAGGAGATGCCGATGTCGGGGTGCACCTGCTTCAGCACCTTGAAGATGTAGATCTTGT
ACGTCTCCACGCTCTTCTTGGACTTCTTCTTGCCCTTCTTCTCGCCGCCCTCCTTGGACGCCGGTGGCCTCTTCTCGGCCTTGGTCTTCTTTGCCGTCGT
GGTCTTCTCGGCCTTCTCCGCCACCGGCTTCTTCTCCGCCTTAGGGGCCATGGATGCCGCTGCCGCTGCTGCTGCTTCGCCGGGGAAAGCTGCGGTGGTG
TTTTCNCTGGGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT
page-top