Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1624
Contig Information
Length 959 bp
Tissue Liquid cultured tissue
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvs6a07    rwhvs1d12    rwhvs6a07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_07611 [Oryza sativa Indica Group]
Score 1256
Evalue 3.08249e-136
Total Hit Count 184
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1624
AGCAGAATCAATAGTATCTTCTTACAACGATGGACTGAAAAGAAAAGAAAAGAGAATACTCATTTCCACAATTGCTTCTTTTCCAACTCAATAAATGAGC
TGAGATATTGTACAGCCGAGGAATCCAGAAGAAAATAAAACTTTCCGTTGGGAAAGTCAAAACAAGGGATGAGCAGAGAAATGCTACCCGAATAATTCGT
GTTTTCAATCCAGACGTTGCTCCCCTAAAGCTCTTGTCGATATATCAGTTTGTCCATGAGGCGGACCTTCTCAAAACTGGCTTCATTGCCTTGTCCTCTT
CCAAGGCTATCATACCAAGATGCGAAGGATCCTCCAGCAGCATCTTGGCGACCAAATACCCGGCAATGGACCAAGTCTGAAATTTCCTTGCCTGCTTGCC
AACATATTTTCCAAGCTTACCATCGTAATACTCAGGCCAGCCATCCTTCAACAGCCTCCTCTCAGCTAGGTCAATTGCTCTTCTTGCAATTTGCGGCCGT
CCAGTTTTGATGCTTGCTGCTGTGAGCAGCCAGAGAAGTACTGGCCAAGATCCTCCATTGTGGTAACTCCATCTCGTATTTTTTGGATCACATCCCGTCA
CGATACGCCATTCATGGTTCTCAATAGCAGGATAGCATATCTTCAGAGGCATCTCACCAATTAACTCTTCCCAGCGCTCCTCAATGAGATCCATTATGGC
CATGGATTGCTCAGGTGTAGCAAGAGATGATACTATGGCAATCATGTTTCCAAGTGCAAACCAACGGAAGTCCATCCTTGCAGGACTGACATTACCAACA
AAAAAACCACCCTCGCAAGGCATGAAATCAAATAGCCAGTCCGGAATAGAATCTGGAATAACATTAAATTTGTTGACAGCTGTATGAGAATATTCTTCCG
TCTTGTAACGATAAATATCATTTAGCTGCTGGAAATCTAGCCAAAAATAACTCCGCATG
page-top