Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1563
Contig Information
Length 925 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs1a07    rwhvs1a07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0175300 [Oryza sativa (japonica cultivar-group)] >gi|113531702|dbj|BAF04085.1| Os01g0175300 [Oryza sativa (japonica cultivar-group)]
Score 111
Evalue 0.001726
Total Hit Count 120
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1563
CGATTGATCTATGAGATGACCTGCTTGGTGGCGAAGGTTTTTTACATGTGCTCAGGTTCTCGTGTCTCGCGTGTGGCAGTACCGAGGAGGGACTGACGAT
GGTCAGCTTGTGCATACTGGCATTGTGGTGCTTGACCAAGAGGGCACCCACATGTATGGCCAGATTCCTGCTAACAGCTCAGGCACGGCGGTGCCCATTC
TTGCCTCTTTCCCTACGGGATCAGCTACACTTGTCGTGCTGCCTCTTGATGAGATGAACACTCCTATATCTGCATTCAAAGGAAAAGGGCAGGCTATTAT
GCCTAAAACACCCAGCAAATCAGCATGCCCAAAAAGTGCTCGCCGCAAACTTTTTACTGAGCCCTCAAAGCCCGAGGACACTGAACTCTCTGCCTCTGCT
GCCAAGGTGGCTAGCCAGGCTGAACAAGGTGCTCCTGCTGGAAATGTTGTTGAAGCTACATCTGTGCCAAATGTCGGTCAAGAAACTGAGCTTATAGCTA
CCGAAGATCCAAAGAACAACCTTCCTGACCACACTAAAGTCAAGAGGACAAACACTGCTGTCAAGCCAGCTGGCGCTCCAAAGAAAGCGAACCAGTAGTT
CTTCCATGGACTAGGCTAGATATGGTATCTTCTATGTTCTGCTTGCTGAAGAGAGCTTCTCAGCTCTGCTGCGTCACAGCAATGGTCTGGCCATCGGGTC
TAAAGATCGTCAACTCTGCACACTTTTGGGCGTGCACCAGGTTTATTTTGTGCAACTTTGTAAGACAAGGCTTTGACACTCGCATAACTATGTCGAGCCA
TTGTCATGACAATTCCTCTATTTAGGTCATCGAACAAATCAAGTACTATGCATTGTAAATATGGCCGTCAGCCCTTTCTGCCTTATCTCCCTCCTTATGA
CAATTTCTACCTTCTGTAAATGCCG
page-top