Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1525
Contig Information
Length 630 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs1a19    rwhvs1a19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 166
Evalue 3.40545e-10
Total Hit Count 24
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1525
CGGCGCTTTTCCACCCTGAATGTCTTCCACTGGACATCAATAATTTGCCAGGGGATTCATGCCCTATGCATGAATGCTACTCGTGCAAGAAAAAACATGC
AACATCAAAGGGTAACAAAACAACAGGAAAAACAAAGGGAAAAGGAACGTGCAGGAAAAAACATGCAACGTTGGAGGGTAATAAAACAATAGGAAAATCA
AAGGGAAGGGGAACGTGGGGAATGGACTTGGTGCTATGCAGGCGCTGCCCCAAAGCATTTCATCGGAAGTGCTTGCCAAGGAAAATCAATGGCGGTGAAG
GTGAAATAAAGAGGATATGGGAGACTGCGGGTGGGACTGTGTTCTATTGCAGGGATCATGAGATGGTAGAAAATCTCAGAAGTGCAAAGAGGAATCATAT
TAAGTTTCGAGAAGAAAAACCTAAAGGTGCGACTGAAAACCAAAGTGTTGAGGATGGGAACAAGTGAAGTGTTCCTGTTGCGAAAAATATGGCCGGACCT
GTGGTGGCCTCCCTCCATGATTTATCTTCCNACTTGTTGGANAAANGAANCTTGTCTTGNGCTCTTGNANAATCNCAAANATANTGANNTGANNACTTTG
GTGTCNTCTATNACNNATNNCNTTNTCTGC
page-top