Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1519
Contig Information
Length 505 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs1a18    rwhvs1a18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera]
Score 74
Evalue 8.68079
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1519
CCTCGTGCCGCTCTCTCTCTCTGTCACATTCGGCAAGTGGTCCGAAAATCGTGGTTCAGGAGAGGAATAAAGTGAGGGGAAAAGCATGACCATTTTTTCC
ATCACAGAAGCTGCACGCAAGGCACGTGTACATAGCGAAGGGGGCTTGTCGTCTGAATCAGGAACTTGCATGACATGTTTCATCTTGGCTGCGTTTGTCC
ATAACACGACATCGTTGACTCGAAGACCACCACTGCTGGGAACATTATGATTCCCGGGCTCACGGCAAAATCAAGCATAACTGCATCCACCGGAGGATAA
CTCCGGCATGTACTTAGAAGACTGAAAACGGCTATGCCATTTCAATTTTCTTCTTCTTTTCCACTGTTTTTGTGCTTAGGAATAACAGCTGACGAATGCG
GTGAAATTCGGGGTTTGCGTTGAGTTGAACCAGTCAGCCATTTGTGTAGCTGAATCTATAACCACCACGCGATGGCGCAATGATGATTCTTGTATAAAAA
AAAAA
page-top