Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1471
Contig Information
Length 865 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs1a24    rwhvs1a24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Tetraodon nigroviridis]
Score 86
Evalue 1.2104
Total Hit Count 45
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1471
GTGACCTCCGGCGCCGTGCAGCACGCCCCCGAGCTCCCCACGGTCCACGCGTCCCTCCCCTCCGGCCAGAGTCTCCGCTCCCGTCCTCTACCGCCCGCTC
GCAAGCCCATCCCCCATGGCTAGGGTTTCGGGTAGGGCTTCGCAGCCGCGTCTCCGGCTGCCCCAGGGGAGAAATAAGGGGAGGTATAGCAGGGCGTTGG
ACATTTGCGGGAGTGGGGGAGATCGATGAGGACGAGGACTGTCTGGTGCACTGCTGGTGCGGGGAGGGCAGGGGAGAGGGATGGCTGCTGCGCTGCTGTT
AGCTGCATATAGGACAGACGATGAGCGAGCAGAGGATTTATCCGGGACCTAAATTTGGCAGGCAAATGGGTGAGCTCTCACATCCCTCTCGGTCTCCTTT
GATTTGTTGCAGATTTCTTTGAAGTCCATGACCTCTCTCGGGCCTTGGCAGTGGCGAGCTAGGTGCCGGCGAGGTAGGCGACATCGTCAACGAGGGCCAT
CATGGCCTCCACCTGCGCCCTCTTGCAGGTCGACTGCTGGTCATCGATGCGGCGGGTCGGGCTCTTGCAGCAACATCTACGATATTCTCTGGACGAGCTG
CAGTGTTGCTCTTTGGGGATTCCTGTGGGATCTATTTTTGATTGGTCAAAGCTGGTTTGTTGGCCACCGGTTGGTTTAACATGATGCTATAATGCGCTAC
GGAGAGATATGTTATTCCAGTACAAGTGGCCGGTCAGTTAATTTGAGGATTTCTGCCTTTTGTTCTTCAGGCCTATAGCTTTGTGGTTTCAGTCCGACAG
TTAAAAGTTGTATTGGCTTGTAAAAATTCATGTGACTGGACCAGTAGGTGAGGATGATCTCATAT
page-top