Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig48
Contig Information
Length 682 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl52a11    rwhfl52a11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hydrogen-transporting ATP synthase, rotational mechanism [Zea mays] >gi|195608344|gb|ACG26002.1| hydrogen-transporting ATP synthase, rotational mechanism [Zea mays] >gi|195647528|gb|ACG43232.1| hydrogen-transporting ATP synthase, rotational mechanism [Zea mays] >gi|195658703|gb|ACG48819.1| hydrogen-transporting ATP synthase, rotational mechanism [Zea mays]
Score 590
Evalue 2.77795e-59
Total Hit Count 32
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig48
cgtcctactcccccctccctctcgatctcctCCCACCTCACCTCCTCCTTGCCTCTTGCCGACGTTTCGTCAAGGTTCCGGCGGCGATGGCGGCGAGGCT
CGCGCAGCTGCGGACCAAGGCGGCGCAGGCGGCGGAATTCGCCTCGAAGCACGGCGGCGCCTACTACAAGGAGGCGATGGAGAAGAACAAGCAGTACGTC
GTGCAGCCTCCCTCCGTGGAGAAGTGCCAGGAGCTCTCCAAGCAGCTCTTCTACACGCGCCTCGCGAGTCTACCAGGCCGCTATGAAGCATTGTGGAAAG
AGGTTGATGGTGTCAAGCAGCTTTGGAAGAACAGGAAGGAGCTCAAGGTGGAGGACCTTGGAATTGCAACACTGTTTGGGGTTGAGCTTTATGCATGGTT
CTGCGTAGGCGAGATTGCAGGCAGAGGATTCACCTTAACCGGCTATAAGGTCTGAATTAGATGTCGAGGCGCGCCTTATAATATACTCTTAGCTGATGCT
TGTCGAAATTACCTGTCTTgtttcacaattttgtttctgaaaagtttttagtgctgaatgccagcatgacgagcacacaattgcaacagtgcctcaataa
tttgctcgctcaattgtccattatttttttgtggtctgtaacttgttccactgacacctgctgcaccgctcttgtgttgtct
page-top