Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1317
Contig Information
Length 774 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs1b04    whvs10l06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1054
Evalue 5.67381e-113
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1317
GCGCGCACACCCTCGGGTTCGATTTGCGCTACCGCGGAGGAGCATCGTACGAGCAATTGCCGGCGAAGAGAGTCCCCAGCGCGCATCCCTCGCCCGTTCC
GGATGGCTGAGCAATTCTACACAGTGGCATCTGACAGTGAAACCACCGGGGACGACAAAGTGCAACAATCATTCCCTGATGTTGCTATCGGCATTGATAT
TGGCACTTCAAGATGCAGTGTTGCTATTTGGAATGGTCATCAAGTGGAGCTGCTGAAAAACACTCGCAGCCAGAAATGGATGAGGTCATATGTCATGTTC
AAAGATGACACCCTTTCAGCCGGTGTTACTGGAGGAGCAACCAAGGAGCACCCACACGAGGAAAGAGATATCTTGTCAGGAAGTGCAATATTTAACATGA
AGCGTTTAATCGGGAGAATGGACACAGATGAAGTGGTTCAAGCTAGCAAGACTCTCCCTTTCCTTGTGCAGACACTGGGTATTGGTGTGAGGCCATTTAT
TGCAGCTCTGGTCAACAATATGTGGCGCTCCACAACTCCTGAGGAAGTTCTTGCCATCTTTCTTCTTGAATTAAAGGCCCTGGTGGAAATGCATCTCAAG
CATCCAGTGAGGAATGCTGTTCTAACCATCCCAGTTGCATTCAGTCGCTTCCAGCAGACCAGGATCGAGAGAGCATGTGCAATGGCTGGACTGCATGTGC
TGAGGCTTATGCCAGAGCCCACTGCTGTTGCTCTTCTGTATGCTCAGCAGCAGCAGCAGCTTATGCATGATAAC
page-top