Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1296
Contig Information
Length 853 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhvs1f08    rwhvs13b06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 1094
Evalue 2.14437e-120
Total Hit Count 421
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1296
ATTTCCTGCTCAATCAAGGTTTAACATAACTGCTGTGAAGCAGCAGGAATTGTCTTACACTTCGTAACATAACTACCGCTACTAGTACATCAGAGCAAAA
CAGATAGCAGAAACAACACAGCCACTTCTTTTCTTCCTCTTTAACTTCACTTTTGCTTCTTGGGCATCCTGTAACCACCAACTACGCAAGCGTGGTCGCG
CTCGAAGGGCTCCAGGGTCACCTGCTCTGAGGGCTTGAACTGGTCGGCCTTGAGCTTCTCCACTTCACTGGCGAACACGGCCTCGGCCGCCTGGGTGGAG
TCGATACAGTTTGCCTTGATGGAAATGACAAAGTGGCCTCCATTCTTCAAGAAGTATGATGCGTTAAGGGCTAAGATTCTAGCCTGGTCAGGCTGTGCAA
CATCTGAAAAGATAACATCAACCATGCCGACCAGCATCCTGTACTTAGCCGGGTGCCTAGCATCCTCAATGATGGGGATGACATTGGTCCTCTTCTTGGC
CATGTTGACAAGATCCCTACCACTCCGGTGAGAGAACTCAACGGCATACACCAACCCAGTCGGTCCAACAATGTCAGACACATGAGACACGGTTGTTCCA
GAGGCAGCTCCGAGGTACAGCACACGTGTTCCAGGAGCAATCCAGATGTTGTCCACACCACCGAGCACAGCAGCAGCCAGCTTGGACCTGAAGGGGTTCC
ACACCCTGTACTCAACCTTGGATCCGTCCTCGTTCTGGACGGAGACCCTCTTCTCGCCGTAGACGGACTCGCCGGCGACCATGTTCTTGGTGCANAGCGC
GTCCCTCCTTGGCCCTTGGCGATGAAGACGCCGTCGTGCTTGTGCGGCACGAC
page-top