Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1229
Contig Information
Length 1081 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs10b09    rwhcs10b09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera]
Score 87
Evalue 1.3352
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1229
CATCTACATGAAGTTTCTTGTTCGTTTTATTTGGAAATAATCTCGATTTATTCTACCGTCTTGATCGTAAAGCGACATTTTTCTCCTGACACTGTTCGCT
GGTCACTGTGGTGAACCGAACAGCAAATCAAGGACTTTAGAGCCCGGCCACAGACCTCACGGAGCACCAACGATAGCCTCAAGGTGATTCAGCAGAGCAA
GGTGATGAGTACTCAGCTGGCTGGCCAATATCAATGATCTTATCGGCCGGCAAAGCGGAGACGGACGACCACGGTCCCGACTTGCCAGCAGGCGGAGACA
ATAAATGGGATCAAGGGAAGTTGGTCGGGCTCCAGCGGCACATGCTTACCACTGCTGACTGTTGCCGGGAAAGGTATGTTGGTTTGATTCTTTCAAGATC
CCAAACTAAAACAAGTCACCTGTGACATTTGAATGATGCAAAGGTTTGTTGTCTCTTCCCAAGAAATTGTGTGCAGAGAAGCTACCTTGATTTTACATGC
TGAACCTATTTTTGCATAATCAAACACTGACGATAAGAGAGATGAATGTGCAGTATGCTAAATTTGGGTATCCAATTGCAAAAGAATTGGATTATTATTT
ACATTAGAAGCCAGGTTATCACTATGTATTTTAAATTGATCGCTCATGGACCGCTCAATTGGCCATAAACACAACATAATTCGATCCCTCCCTTCAAATT
GGCAACTAAAGGGAAGGTGAGTTAAAATGTCTCAGCCCCTGTGACCTGGCTGGTTATGTTTATATTACATCCAATATTATGTGTACTCATTTGATCTAAG
GTTATTTTTAATAACTTGTTTTTTTTTGTCACGAACAAATCGATGAACCGGCGGTCCAACCGGTGACAGACACAACGGTTCAGTTGCCCGTTCGGTTTTA
AAAAATATAGTCCGATGGTCATGGTGGAAGAACATGACATGAAGTGCTTTGTATCCCAAGAACGATCGAGGAGACATGAGCAGCCGGTGGCAGTGCTTCG
CACTTCAAGCAGTAGGGATACTTGATCATAGGGAAAGGGAAGGGAGATGAGTTCGTGCTTGCATGATTTTTAGGGAAAGAG
page-top