Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig1050
Contig Information
Length 391 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs10g18    rwhvs10g18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit elongation factor [Triticum aestivum]
Score 352
Evalue 4.51418e-32
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig1050
GGTCATCGAGTCGTTCGGGTTCTCAAGTACCCTCAGGGCTGCGACATCTGGCCAGGCTTTCCCCCAGTGTGTGTTCGACCACTGGGACATCATGTCTTCG
GATCCTTTGGAGGCCGGCTCCCAGTCTGCGACCCTTGTCACGGAGATCCGCAAGCGCAAGGGTCTGAAGGAACAGATGACCCCTCTATCTGATTTCGAGG
ACAAGCTCTAAACTTTTAGTTCTGTTATCATATGGGTCTAGTTTGCTTTTGCTGCTAAGAGAGCTGCACTATTATTTTCTGTCTGTTGAGTCGTGGCTGT
ATTGCTATTGGGATGTCCTATCACTTTGTTTTGATGTCTATCGATGTTAAAACTTAGATTATATATCTGTTATCCACTGGTAAAAAAAAAA
page-top