Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig995
Contig Information
Length 1398 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs1d11    whvs14d08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_021409 [Oryza sativa (japonica cultivar-group)]
Score 279
Evalue 1.04362e-22
Total Hit Count 126
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig995
GGTCTCCCCGCGCCTCTCCCCGCGACCCTCGTTCCTCCTCCCGCCGCCGCCGCCGCCGCCCACGATGGACGAAGTGAGAGGAAAGAGCCTCGGGAGACCG
TCGCCTCTCCTCACCGGCCTTCTCCCAGGTTCCCGATCTGGAGCCTCTCCTCACCTTCTCCTAGATCTGGAGCGGGAGGGACGGACGCCGGCGAGGCCAG
CCTCCCCTTCACACACGGAGGTTGTTGAGATTATTGATCGGTATGATCATGCATGTGTCCCACCTAACATGACTGATAATAAGCTTGCGTACATCCAGAA
TGAGGCTATATCCAGAGAGTGCACAAGGACTCTCACGGTTACAAAGGATACGAAGCAGCCAATTTATGCCTACTACCAACTTGACAACTTTTATCAGAAT
CATAGGAGTTCATGCCCCGGTCAAATCTAGAGCTATGCATGCCTATGTCATCTCTCACAGATCACTGTTCTTTTCATTCCTCCAATTGAAACCATGGCTG
CCAGTATTGAGGGTCAGGATTCTGTACTAGACGTGATGAGATAAAATGAGGTCTGAATTTTTTAGCCATGCTTTCTTAGCTCATGAAGGCAGGAGCATAT
GTGATTTTTCTGTACCACCTTCCCGCGGCTCTGAGGATTTTGTCTGCTCGCTGCCTCTCCGCTATTTATTTGTTGTGTCTACTGCATTGTTTGTTCTGCC
ACCCTTTTCCTCAGTTGCTAGCGGGGGGCCTTGGCTTATCGTATTGTTTGTTGCCTTCCTCTCATAGGTTCGTTGGTATTGTAAACCATTTTTGTTGTAG
TAATAACTACAATGTCAAATAAATTTACATTTCACCTTGCTTCCACTATTATTCAAGTTTTTCCCTGCTTATTGGTCGTACTAGCAAGATGGTTTTTGTT
TTTTTACCGTGTCTAACATAGTGTATTTCTACGATTTTTCTCTGTTAAAACATATCCACTTCCATGCTCTTTTCTCTATTTTAGTACACAATAGTATGGC
TGCATACTACCAATTGCAGAAATTATTCATTTGCCACTAAAATATATATTTTCCTATTCACAAATTAAATAACAACAAAGATGAAGTTGGTCCCCGGATG
CCTAATATGTTCTTTCATATCCTGGTCAGTTTACCAGGTAACAGAATTAATACTTCTTGTTGGTTCAATAGTCAATACCAGTGTTGTGAGAAAATTCCTT
ACGGTTGTTGTATTTTGGTAGCTTCTTCTTTTGCAAGTGGCAAATTACTGTTATGTATATGTGGAATCCTATTAAATCTGTGCATTGGTTTCAGTCATAC
TTTTCTAAATGGAGTATAGNTCAAGACTGNTTTGNTCATTAAATCATTCCTTCTACCTTCCAAGNGNGNCNNTGGCACACCTCAAATTACTTCNACTT
page-top