Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig898
Contig Information
Length 710 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs1d03    rwhvs1d03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08046 [Oryza sativa Indica Group]
Score 410
Evalue 2.25322e-38
Total Hit Count 411
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig898
CAAGGTTGCATATGATGATGGAGATGTAGAGGTACTGCTGCTTAGGGATGAAAAATGGGATTTCATCAGTGAGGAAGAAGGCAAAACTCCTGATGTACCA
TCTGAGATACGCCGTGGCAGAAAAGGGAGAGGAATCACGCTGCTACCAGTGAAGGAAGAAAAAATAGAAACACCTAAAAGTGACGGAGTGGAGCTTCCAA
AGAAAAGAGGCCGTCCGAAAGGTTGGCGCCCCAACAATGGTGGTACACCGTCTACAACTCCAAGCAAATCGAAGGGGAAAACTGCTGTCAAGGATGCCAA
GGGGACACCTAAAACTGCCGTTGAGATTAAGAAAGAAGGCAAGGAGAAAGCCACTGGATCAGCTAACAAGACGAAGGATGATTTAGCTAAAGACAGCAGC
AACCAGAAGCTGAAGGAGGTTGGGAGCAAATCTGGCGATGGATCTGTGAAGGGTAGGCCTGGGCGGAAACCAAAAAGCGCTGCCACTACTACTCCAGTGG
CGGGTAGTGGATCTGGATCTGTTCAAGAGAAGCGGAAGGATAAGGAGGAGAAAGAAGAGGCTGAGGCATCTGAAATGGAGCAGGAGGCATCTGGCAAGGG
GGCGTCTTCAACTGGAAAGAAGCGCAGAAGGAAGGCTTAGGCTTGAACCAACCAACCGTGAACTTCCCCTGTAAATGGGTTCGCTCTCATCATGGCACCG
TTGTATGGAT
page-top