Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1198
Contig Information
Length 1300 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs10b16    rwhcs10b16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit quinone reductase [Triticum monococcum]
Score 1303
Evalue 1.72851e-141
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1198
ACCAACCCAACCCCTGAGCATCTCCGGCCACGCATCAGCTAAGCACACGCAAACAGCCGCCCCCACGATACTCACGAGGCTTCTTCCCCTCCGTGCGCTC
TCTTGTTTCCCCCATCCCATGGCCACCCCGACGACCACGCCGGCGACGATGCGGGCCGTGCAGTACGACGCCTGCGGCGGAGGCGCCGCCGGCCTCAAGC
ATGTAGAAGTCCCCGTCCCTTCAGCAAAGAAGAATGAGGTCCTGCTGAAACTGCAAGCTGCAACCATCAACCCAGTTGACTGGAAGATACAGAAAGGGGA
CTTGCGGCCTCTGCTGCCTCGTAGACTGCCTTTTATCCCAGTGACTGATGTTGCAGGAGTAGTTGTTGATGTTGGTCCTGGAGTGAAAGGTGTCACGGTG
GGTGATCAAGTCGTCGCCATGTTGAACTCTTTTAACGGAGGTGGACTGGCAGAGTACGCTGTAGCATCCGCAAACCTGACCGTCAAAAGGCCAGCTGAGG
TTTCTGCAGCTGAGGGTGCTGGGCTTCCCATTGCTGCAGGCACTGCGCTCCAGGCACTGAGGTCCATTGGTGCCAAGTTTGACGGCACCGGCAAGCCATT
AAACGTGTTGGTCACCGCTGCCTCTGGTGGCGTAGGCCTGTACGCGGTGCAGCTTGCAAAGCTAGCGAACCTTCATGTTACCGCCACCTGCGGCGCACGC
AACATGGATCTTGTGAAGAGCTTGGGCGCAGACGAGGTGATGGACTACAGGACCCCAGAGGGGGCGAGCCTGCAGAGCCCCTCCGGCAGAAAGTACGACG
GCGTGGTTCACTGCACCGTCGGTGTCAGCTGGTCGTTTTTCCAGCCATTGCTCAGTGATGCCGGGAGAGTGATCGATATCACCCCCAACTTGTCGGCCAT
CCTCACATCTGCGCTGCACAGGGTGACATTTTCCAAGAAGCGCCTGGTGCCCCTGCTCCTGTCGCCCAACAAGGCGGACCTGGAGTTCTTGGTTGGGTTG
CTCAAGGAAGGCAAGCTGAAGACGGTGATCGACTCCAAGTTCCCGTTGAGCGATGCAGGCAAGGCGTGGCAGAGCAGTATCGATGGCCATGCCACTGGTA
AGATTGTCGTTGAGATGGAGAGCTGATCGTCGTCAATGTTTATTACTACTAGTATTACCAAAGAACTTGCATACAGACAGTGGAGGCGAATACTTAGATG
TAATCATACAGACTAGTCACTTGTGCGTTTGTTTATTGGGGTGATGTTCGTTTATTCAGCTTAGTATGTTTATTGGACAGAGAGATAAGTTGCAAAAAAC
page-top