Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1192
Contig Information
Length 844 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs10b11    rwhcs10b11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195618520|gb|ACG31090.1| vacuolar ATP synthase 21 kDa proteolipid subunit [Zea mays] >gi|195629280|gb|ACG36281.1| vacuolar ATP synthase 21 kDa proteolipid subunit [Zea mays] >gi|195653101|gb|ACG46018.1| vacuolar ATP synthase 21 kDa proteolipid subunit [Zea mays]
Score 753
Evalue 5.30469e-78
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1192
GATCCAACCATCGCAAAGAGAGAGAGAGAGAAAAAAAAATCCCCGATCCAGCACCGAGCTCGCACCGGTGGAGATCGTGGTGGGAGGATGTCGTCGGACT
ACTCGTCGTCGTGGGCGCGCGCGCTCGTGCATATCTCGCCCTACACCTTCTCCGCCATCGGCATCGCCGTCTCCATCGGCGTCTCTGTACTCGGCGCAGC
ATGGGGGATCTTCATCACGGGGAGCAGCCTCATCGGGGCCGCCATCAAGGCGCCCAGGATCACCTCCAAGAACCTCATCAGTGTCATCTTCTGTGAGGCC
GTTGCAATTTATGGTGTAATCGTGGCGATCATCCTCCAAACAAAGCTTGAAAGTGTGCCAACATCCCGAATGCATGATCCAGAGTCTATGCGAGCTGGTT
ATGCAATCTTTGCCTCAGGTCTTATTGTCGGCTTTGCTAATCTTGTTTGCGGGGTATGCGTGGGAATAATCGGAAGCAGCTGTGCACTGTCTGATGCCCA
GAATTCAACACTCTTTGTAAAGATCCTGGTGATTGAGATCTTTGGCAGTGCTTTGGGCCTCTTTGGAGTGATCGTGGGCATAATCATGTCAGCTCAAGCA
ACATGGCCAACGAAAGTCTAATTCCATCCATCTGGGAATCTCTGTAAATTATTTTGGGTGAAGCCCTTTGGAATGTCAACATGTGTTCAACTGTTTCTTA
TCTATTCTTTTCTCTTTTGCACGTTTTTGGTAAATCACGTATTTTGGTGCTTGATGCATCTGATCGTAGAGATACTGTTCCTACTGTAAAGACTCCATAT
GCCTGCCAGGTATCATCTTGTAGGTGCTATTGCTTTGCAGAACG
page-top