Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1190
Contig Information
Length 1292 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs10b21    rwhcs10b21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative WD-40 repeat protein [Oryza sativa Japonica Group] >gi|125597766|gb|EAZ37546.1| hypothetical protein OsJ_021029 [Oryza sativa (japonica cultivar-group)]
Score 545
Evalue 1.11314e-165
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1190
CCGATCGCGCGCCGCCGGAGCCGATCGATAGGGTTAGGGTTAGAGGGGGAAGGGGCTGAGATGGAGAAGAAGAAGGCGGCGGTGCCGCTGGTCTGCCACG
GCCACTCGCGGCCGGTCGTCGACCTGTTCTACAGCCCCGTCACGCCCGACGGCTACTTCCTCATCAGCGCCAGCAAGGACTCAAATCCAATGCTTCGTAA
TGGTGAGACTGGAGATTGGATTGGGACTTTTGAAGGTCATAAAGGTGCTGTTTGGAGCTGTTGCCTTGACACAAATGCTCTGCGTGCTGCCTCTGGTTCT
GCAGACTTTTCAGCTAAAGTATGGGATGCACTAACAGGTGATGAACTACATTCATTTGAACACAAGCATATAGTCCCGTGCATGTGCCCTTTTCTAAGGA
CACCCACCTGTTGCTTACTGGAGGTATGGAAAAGATTTTGCGTGTATACGATTTGAACAAACCAGATGTTGCTCCGAAAGAACTTGACAAATCACCTGGT
TCTGTCCGAACTGTTGCTTGGCTTCATAATGACCAAACTATACTGAGTTCCTGCACTGATACGGGTGGAGTAAGGTTATGGGATGTGAGGAGTGAAAAAA
TTGTCCAAACTCTTGAAACCAAGGGACCTGTTACCAGTGCAGAAGTAAGCCAGGATGGCAGGTTCATCACCACAGCTGATGGCTCAAGTGTAAAATTTTG
GGATGCTAATCACTTTGGGCTTGTTAAAAAGCTATGATATGTCGTTTATTGTGGAGTCAGCTTCACTTGAACCGAAGTCCGGGAGCAAATTCATTGCTGG
AGGAGAAGATATGTGGGTTCATGTATTTGATTTCCTCACCGGTGAAGAAATAACCTGTAACAAAGGGCATCATGGTCCAGTTCACTGCGTCCGGTTTGCA
CCTGGTGGCGAATCATACGCCTCAGGGTCGGAAGATGGTACTATTCGGATCTGGCAGCTGAGCCCACCTAACGTGGATGCTGAGGAGGCGGTCGATACAA
ATGGTAAACCCAAGGCTGGAGCAGAGGAGATTGCGTGTAAGATCGAAGGCTTCCACATTGCCAAGGAGGAGAAGGCCGGGGAGTAGGATTACATCGTTGG
ATGAGATGCTGTTGTGTTATCCTCAAAGCTGCTCTTTCCGCCTTGCCTTGCGTCTGTTCGTCAAAGCCGGTGTCCGACTTAAGTGTGGCTGGCTTGTATG
AGTAGTTAACTGCGCCGTGGGAAAAATCTTGCCCTTCATCGAGCAACTGCTAGGGATTTTTTGGTACACCGAGAATAAGCCAAGAGTAGAAC
page-top