Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1189
Contig Information
Length 812 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs10b04    rwhcs10b04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0256200 [Oryza sativa (japonica cultivar-group)] >gi|62734754|gb|AAX96863.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|77549626|gb|ABA92423.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113644856|dbj|BAF27997.1| Os11g0256200 [Oryza sativa (japonica cultivar-group)] >gi|215765972|dbj|BAG98200.1| unnamed protein product [Oryza sativa Japonica Group]
Score 649
Evalue 5.63129e-66
Total Hit Count 126
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1189
CACCTCCACCTTCCGTCCCCTTCCGACCGACCGCACCCTTCCCTCCCGTCTCCCCCTTCCTCAAACCAAGCCGGAACCAAATCGTGAAGCTCGATGGACC
ACGCGGGCTCCATGGAGGAGAGGATCGTGGCGGACCGGATCCGGAAGAAGCTGGAGGAGGTGAACGTCGCCGCCCACAAGCACCTCGAGGGCGTGCAGGA
CCATGTCAACTTCACTCTGCAGAAAGAGTACTTCAAGTGTGCACATGACTGCTTCGATAGGCGACGGACTCAAGAGGGGATCACCAGCTGTGTAGAGAAC
TGTGGTGTGCCCGCTCTTTCTGCCAACAATGTTGTTGAGACCGAGATGGCCAAGTTCCAGGAAAGGTTGAATCGCTCGTTGATGGTCTGCCAAGACAAGT
TTGAAGCAGCAAAGCTCCAGAAGATGAAGACAGACGCAACCAATGAGCTGGAGTCGTGCGTGAACAGATCCATCGACGACAGCATCAGGGTCCTGCCCCA
TCTGGTTGAGCAGATCAAGTCCACCATTAATATGAAGTAGAGGAATCGGAAACTTTCCCCGGCTCGTTTTTGCTATCGTTAGCTGAATCTATCCAGAGTC
TCTAGCAACACTAGTGTAACATGAGCATTTACTTCCATGAGAAGTCCAGAGAAGGGTTTTTTGCTGAGAGATACTAGACTCAATGTTGCAAACGTTGTTT
TTGCATAACATCCTTTTATCTTAATCTCATGTATTATATCCATAGTCTCTGTAATTTGCCAGTTTGCTTGGCAATGTANCCATGTAGGTGAGGGCATTTC
ATAAAAAAAAAA
page-top