Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig431
Contig Information
Length 1106 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs1c03    rwhvs1c03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0691700 [Oryza sativa (japonica cultivar-group)] >gi|18565419|dbj|BAB84606.1| putative phosphoprotein phosphatase [Oryza sativa Japonica Group] >gi|113533468|dbj|BAF05851.1| Os01g0691700 [Oryza sativa (japonica cultivar-group)] >gi|125571653|gb|EAZ13168.1| hypothetical protein OsJ_002993 [Oryza sativa (japonica cultivar-group)] >gi|215695520|dbj|BAG90711.1| unnamed protein product [Oryza sativa Japonica Group]
Score 901
Evalue 5.19933e-169
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig431
CTCTCGCCACCCCCTTTGATTGGATCGAAAAACAAAATCGTCGCTCCCACCAAAATCCAATCCCCAATCCGCCGAAACCCTAGCGGCGAGGAACGGGAGG
CCGTAGCCGGGGGATTCCAGCACTCCGGCGACATGGATTTGGATCTGTGGATCGTCAAGGTCAAGGAGGGGCAGCACCTCGCCGAGCACGAGCTCCAGTC
CCTCTGCGAATACGTGAAGGAGATCCTCATCGAGGAGTCCAACGTGCAGCCGGTCAACAGCCCCGTGACGGTGTGCGGCGACATCCACGGCCAGTTCCAC
GACCTCATGAAGCTCTTCGCCACCGGCGGCCATGTCCCCGACACCAACTACATATTCATGGGCGACTTTGTGGACCGCGGGTTCAACAGCCTTGAAGTCT
TCACCATTCTTCTGCTTCTAAAAGCTAGGTATCCTGGCCACATAACCCTTCTGCGTGGGAACCATGAAAGCAGACAGTTGACACAGGTGTATGGCTTTTA
TGATGAGTGTCAGAGGAAGTATGGGATGCGAATGCATGGCGGTATTGCACTGATGTTTTTGATTACCTTACTCTTTCAGCAATCATTAATGGCACAGTCC
TCTGTGTTCATGGTGGGCTTTCACCTGATGTACGCACAGTTGATCAGATGCGGACAATTGATCGCAACTGCGAAATTCCTCATGAAGGACCTTTTTGTGA
TCTAATGTGGAGTGACCCAGAAGAGATAGAGACATGGGGTGTTAGTCCCCGTGGAGCAGGTTGGCTTTTTGGATCACGGGTGACAACCGAGTTTAACCAT
GTTAACAATCTTGAGTTAGTTTGTCGGGCTCATCAACTAGTCCAGGAAGGCCTAAAGTACATGTTCCCAGACAAGGGTCTTGTAACTGTGTGGTCTGCAC
CTAATTATTGTTACAGATGTGGGAATGTTGCTTCTATACTAAGCTTCAGCGAAACTATGGAAAGAGATGTCAAGATCTTCACAGAGACGGATGAGAACAA
CCAGATGCGAGGGCCGAGAAGTGCGGTCCCGTATTTCCTTTGACCTCCTTTGTACATTTTTTTTTGGCGATTTTCACTTTTGGTGCTCATTGTTGTAGCT
TCAGCT
page-top