Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig397
Contig Information
Length 903 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs1b24    rwhvs1b24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_024159 [Oryza sativa (japonica cultivar-group)]
Score 784
Evalue 1.51495e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig397
GCGCCGGCAGATCTACGCGGGCGGCGACCCTATTCGTCGGCGGCTCACCTTTCGCGACGCTCCTCTCTAGCCATGTCTACAATGAAGGGGCAGACAAGGA
GGGAGAGGCCTAGAACTCGTCCTCATGGCCTCACGCAACAGAAGAGGCAGGAAATAAAGGAAGCGTTTGATCTTTTTGACACCGATAACTCAGGAACCAT
CGATGCCAAGGAGCTGAATGTTGCGATGAGAGCCTTGGGATTTGAGATGACAGAAGAGCAAATCAATCAGATGATTGCTGATGTTGACAAAGATGGCAGT
GGATCGATAGATTATGAGGAGTTTGAGCACATGATGACTGCCAAGATTGGGGAGAGGGATACTAAAGAAGAGCTTACAAAAGCGTTCCGCATCATTGACC
AAGATAAAAATGGGAAGATTTCAGATGTTGATATTCAGCGTATTGCCAAGGAGTTGGGTGAAAACTTCACTCTCCAAGAGATCCAAGAAATGGTTCAAGA
GGCAGATCAAAATGGTGATGGTGAGATAGATTTTGGCGAGTTTGCCAGGATGATGAAGAAGACCAGTTATGGCTACTAGGCGGGGATGGCATCTGCGAGT
GTCTGATCTTTGTGTAGTTGTTCAATAACCACCGCATGTTTGCCTAATGTACCTACTGCTGTATCTACTCTGAGCGATCCCGTTGATCTCTGTGTGCTTG
TTATTGGAACATGTTTCTGCAATGGAGGTGTCCGACTGCATGCGCCATCCTCTACCCTGTGATTTCACGATGTGGTGATCTACAATGCTCTGTGATCCAG
GTTGTGCGATGGCATGTTGTTTACCTGACGCTTGCGACACCATTATCTTTTTTTCTCTCTTATCTTTTTGAACAACACATGATAACTGTTGTATCAGCTC
GGC
page-top