Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig393
Contig Information
Length 825 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs1b06    rwhvs1b06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0139000 [Oryza sativa (japonica cultivar-group)] >gi|38636774|dbj|BAD03017.1| putative RNA recognition motif (RRM)-containing protein [Oryza sativa Japonica Group] >gi|113622933|dbj|BAF22878.1| Os08g0139000 [Oryza sativa (japonica cultivar-group)] >gi|215767574|dbj|BAG99802.1| unnamed protein product [Oryza sativa Japonica Group]
Score 497
Evalue 2.44632e-48
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig393
CTCTCACGCACGCAAGCCTTTTCCCCCATTCTCCGGCGGCGGCAGCTATGGCGGCGGTGGCGGCAAGGTCCGGGCTCCGACGGATGTTCTCCATCGCCGA
CTTCGCGCCGAACACGCGCATGTTCTCCATCTCGGCCTTCGCGCCGCCGAGCCCGCCCACGCCTCCCCCGAAGGCCGACCCCTCCCCCAACCTCTTCGTC
TCCGGGCTAAGCAAGCGTACAACAACTGATGGACTTAGAGAAGCTTTTGCAAAGTTTGGGGAAGTTGAACACGCTCGAGTTGTCACAGATCGTGTCACTG
GTTTTTCTAAGGGGTTTGGCTTTGTAAGGTATGTTTCGGTTGAAGATGCAACTAAAGGAATAGAAGGAATGGATGGAAAATTTCTGGATGGATGGGTTAT
TTTTGCCGAATATGCTAGACCCAGACCACCGCCGCAGATGGGAGGGGCAACTCCGCAGCCACAACAATCATGGGGCACTCCTTCTGGTTCCTGGGGCTCA
CAGTAGATGAAGGGACAATCATTCTACCTGGCTGTGCGTCTGACAGCGTATCAGTCAGCCATCGCAGTCTACATTTAGATCATAGCTACCATGGTGTTGT
CCCAGGTGTGAACACCCTTGCCTGATCCAATATTCTTGTCGTGTTGGACTGGTCGTTTATGGCCTCCACATGGAGAAGCACTAGGGGAACCTTATATGGA
CCGAGCAGGTATTACTGTCAGCATGCAACAGCTTCGGACCATTGCTAATAATGTCTTCTTGTCCCTTTTATTTGAATTGTCGTAAGCCTTATCAGCTGCT
GATGGCATGTGCTGCTCTTGTACTA
page-top