Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig300
Contig Information
Length 989 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs1b08    rwhvs1b08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative pentatricopeptide (PPR) repeat-containing protein [Oryza sativa Japonica Group] >gi|215697127|dbj|BAG91121.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1055
Evalue 8.93376e-133
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig300
GAGGACGCCGAGAAGCTCATGGCTGAGATGAGTCGCAAGGGGTGCCCCCCAAATGTGGTGACATTCAATATGCTCATCAGCTTCTTGTGCCGGAGAGGAT
TGGTCGAGCCTGCGATGGAGATTCTTGAGCAGATCCCCAAAGTACGGGTGCACGCCCCAATTCGTTGAGTTACAACCCAATACTTCACGCATTCTGCAAG
CAAAAGAAGATGGACAGAGCCATGGCGTTTGTGGAACTGATGGTGTCCAGTGGCTGTTACCCCGACATCGTCTCATACAACACTCTTCTTACCGCGCTGT
GTCGCGGCGGGGAAGTTGATGCCGCTGTTGAGCTGCTTCATCAACTGAAGGACAAAGGCTGCACCCCTGTCTTGATTAGCTACAACACCGTCATCGATGG
CCTTACCAAAGCCGGCAAGACAGAGGAAGCTTTAGAACTGCTGAATGAGATGGTTACCAAAGGGCTCCAACCGGACATAATCACTTACTCGACAATATCT
TCTGGTCTTTGTCGGGAAGACAGAATCGAAGAAGCGATCAAAGCATTTTGTAAAGTGCAAGACATGGGCATAAGGCCCAACACTGTGCTGTACAACGCGA
TACTTCTTGGGCTCTGCAAAAGGCGTGAAACACACAGTGCTATCGATCTGTTTACTTACATGATATCGAATGGCTGCATGCCAAATGAATCGACCTACAC
TATATTGATTGAAGGCTTGGCTTACGAAGGCTTGGTCAAGGAGGCACGGGAAATGCTGGCTGAGTTGTGCTCCAGAGGAGTGGTGAGTAAGACTTTGGTA
AATAAGGGAGCCATCCGGTTACTTGATGCTTGAAGGAACTATGCATACTTAAAAAGGTTGAGCAGACCAGTAGGAGTGTGTGGATCCAGGAATATGTTCT
TCTGCATCTTCGGCAGTACGTAGAGATACTTCATTGTTCTTAATGATGTCTTATTCGATGCTGCCTTCTTATGAAACATGTGAGTCTCC
page-top