Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VSCB_all.Contig140
Contig Information
Length 688 bp
Tissue Liquid cultured tissue
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvs1e01    rwhvs1e01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Physcomitrella patens subsp. patens] >gi|162693435|gb|EDQ79787.1| predicted protein [Physcomitrella patens subsp. patens]
Score 825
Evalue 1.59541e-86
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VSCB_all.Contig140
CCTTGCCGACTCACATCCAGAAGGAATCCACCCTCCACCTGGTGCTCCNCNTGCGTGGTGGCATGCAGATCTTCGTGAAGACCCTCACCGGCAAGACCAT
CACTCTGGAGGTTGATAGCTCCGACACCATTGACAACGTCAAGGCTAAGATCCAGGACAAGGAGGGCATTCCCCCGGACCAGCAGCGCCTTATCTTCGCA
GGCAAGCAGCTGGAGGATGGTCGCACCCTTGCCGACTACAACATCCAGAAGGAGTCCACCCTTCACCTGGTGCTCCGCCTCCGTGGTGGTATGCAGATTT
TCGTGAAGACCCTCACCGGCAAGACTATCACCCTTGAGGTTGAGAGCTCTGACACCATCGACAACGTCAAGACCAAGATCCAGGACAAGGAGGGCATTCC
CCCGGACCAGCAGCGCCTCATCTTCGCCGGCAAGCAGCTGGAGGATGGCCGCACCCTTGCGGACTACAACATCCAGAAGGAGTCCACCCTCCACCTGGTG
CTCCGCCTCCGCGGTGGTCAGTAATTGCCCTGGCGTTGGACCTGCTGGTTTATCCTTGGTCGTCCGGTTGGTGGTACCCTGTCGTTCATTTGAACTGTTT
TCTTGTTCGTGTCAGTCCTATGTGTTGGTTTGAAAACTATCGAGTCCCCATGTTATATGTTGGTTGAAAATGTTGCTGGCACAGAAGA
page-top